Description :
From Genome Similarity Track
Location :
Scaffold_72:40895- 44706
Transcript NameFunction/comments
Phyca_LT1534127784IPT/TIG domain containing protein
Phyca_LT153411478predicted protein

Sequence
3811 bases(100 bases per row)
cattgcggatggcgcagcgagagctcctgcatgaactcatagagcgcagtcgagagcgtgtggtgcaggtgcgcgctggtagtagtttactccacgtcct
gcaccaggagcagctgaaagtttctcccccgttggccacttcaacctcattgccactgctgccccccgcccccacactcgcaattgcagccaagcgccga
acacacaaaagttcccatgcacaagtagtagataacgaacacaaaggtcgacgaagacgtggagctctgccacgactcgccaaggacgtagtgcagctgc
ccgaaggcacgacctccttcgagcagtatcagaacttcctggccaacaaaatctacaagcaggagacgatgcatttgcagaaacgtcgggcagcactcat
ccctaaggcagatctgctcaagaaattggcgacagtctgcgccgcggcgttagaggagatggaggccgatggggatgctccgtctgtacacgagtcactg
agagagaaactgctacgggcgatggcactgcttagaggaggacgagcctttaagcaagccaaatcactggcaccacccccacctcctgcgtatggggaga
taaagaacgcccacctggcgttcctccagttcagacacgatgaagtgaatggagcgaagaaaaaacaagttcacccgtgggtgttttttggcgctctaag
ggatttcacatctcttgtttacactaatacgcttcactgtgaacggtaggagtgctggcttgcaagatggcaatacgtcgaccaagacgccgattcactt
tggtgaccaaatttgcctactctcatcgagctctgacttacctctcgctattgggcccgatggccgcagtcgacctgctcaagacagctctgctggacca
cacatgacgttcaccatcgtgcgttgctcttcgcaatctctcagtgtggaagacactaacattacctttgctcaggtggacttccgaaacccgtcgcgtt
gcgatgaggtcacatccacagatgatttctggctacgtgttgaccctgcagtcctgggacctcgcaagttcaatcctcgtcgacttcattgcaatggtga
tgacaatgatccgtcaaatgatggaggtgatggggatgtatcctcgcttcttagtgacacaagctactatctcggctgtccgggttggcaagacgatgat
gaatctgatcctgttccttcgaaaagggtttcaataccgactcgcaatggaaatactcaaattgacgaacgtcgggtgcatggacaaaagcactttcggc
tagtagctatgaaagctttgattccctcaagagatgtctacggagatgatgcggcaacacgcgaatacgctgtggaaaccaacgaaggcatcatgcgctt
ggcacgctggcgatttgtgcggtataccccacgaaaacacgagcaactcggtgggaaggcagaagctgttcacaatggagttttgggggatgaacaagat
gttaatgatgccatggtgaattgctcaatggtatatctagttctgagtgactttgcactcgtctatgacgctggtctcaaacgaggtgtgggcgtgcgcg
tgtcttccgacgctcatgaacgttcgagtgtggaaaaactccatcaaaatggtgttaatgtgaagaaggaacattatcgtcaccgcaacgatagtaaaat
gatcgcaaatgtggtgcatctttccgcgtgtgcgcggtggcaagtgcgtatattacagcgcaccggtggcgtcaattatttgcaggaacttgaattggcc
atggcggcagtgactggagactatcggaaagaggacggtgcgcgtgtggaatggttgcgtgaaaagcaagagaaaatggtttcagacaatcgccgactac
acgtgaaaacaagactggttcctgaagctcggcgccaatatgatctcgttgctgctcaaagcaacagcaagttggagcagattgagcgtcagaagggggc
acaagctacagaatatttccaacgacgtcttcacgagatcgagacacaggaaagcaagcatcaaccgtatgagattttacatttgaaacagcaacagctt
caacgcgtcgttgagctcccacgcctgtgaggcgaaattggaaactatccgatacgtgttcaaaggttatcacccttcccggttttcgccggcattgctt
tgccgtgtttcttacgcttctcgcgttttcgtcgcttgcgattttctttttgagcagcggatagcaccttccgctttgtgccagtttgagtagtcccagt
ttccacagtacttccagtggaggaagctggtgcaggagcttcagaggttgcagcacttgaagtttcaatcgtttgcttagctttttcgttaacctctgcc
ggagcgccaccaattcggtcagttcgttcaaaatacgccacgaagaacccattcgtggagtcctcgaggccattcgcacgcacaagagccttggcctgtt
cagtcgacagacctgccacctcgagtccacgtcgtggccatgaagtcagagcgggcttcaggacaaatggtcgcgtggctcgaatattctcgtcggattt
caaagctgcagcgacaacctcctcgtcctctttctggaagatggaacaggtcgagtacacgacacgctccacttgtgggaaggagaaggctttgcgcagc
gcctctagttggaaatctgcgagtgattggagacgcttcgccgtgtcctcctcgtactctgcaccatggtcgggttccagaactgtatcacgtgaactcg
caatgtccaacaagtgatccaaacgatttgtcatgcccgatccagaacacgacgggtccaaaagaatactgcgcacgttgcgatacatctcgccgtccac
cggaacttccaggaagctttggagctccgcctgaacgcgcgtcgcagctcctgcaagcttcattcgccgtttcaatagttccagtctcttcggcgatcga
tcgaatgcaaacactcgtcttttcggtgtggaatcatcttccccgtctccatcctgctgttgcagcagcatggccagatgactggtcttgttgcccggcg
cggcgcaagcgtctatcacgtccccctgcttgtccttgctgtccgagtgctctccgtgaagcacgaacgctggaaaacaactggctttgtcctgcagcac
gagctttccgctcttgaccatctcgtgttcgtgcaattccgtacccgaaggcagcacgagcaggtcacgcacgtctcggtcttgtttggcgtcattatcc
ttcgtgaaggcctcagcctcttcaggggaagccagcagcgtattgacacgtacataacgcggtagtgaaaggtgttgttggcggttctccggcggcaata
aagcctcgttggatgccactttgcgtttgatcttaagccttgccaaagccgctcggaaggccgtttgatgctgcacaagcgctttcttgacgtacccacc
gccctgaatcttttggcgaccaaatagcaggtcgtagagcgccacaaacacgagagcaggcggttccttggcggttttaggcgtcttgagcgccttgtgg
cattcgggaacggctgccagtagctctcgcagcagcggtttgtacctcagcgtctcgcacacgagcgcgaacgagctgcgcttgtgcactgtggattcgg
cgtatgcgaggcttttgagtccgccctggcgcagctccagtttgtgcagcagcgccgccgcctccttgtagagttcgctcatggtcaaaaatgccaaaaa
tggctggacgc