Description :
From Genome Similarity Track
Location :
Scaffold_784:4088- 5472
Sequence
1384 bases(100 bases per row)
TGACTATGGTTGCACAGCCACAGTCAGACGACGCCGAGGTAATAATTCCCCACGTACTTGAGAGAAGGATTTCTCAAGAGTCACATACTGAGAGAAAAGG
CTCTCAGCAACCTGAGGAAACAAGTTCCCAGGAAGTAACCGAGACATTGAATGTCTTGGTCAATGACGGATCAAACGTAGGCGCTTATACGCTTGATCTG
AATGTGCCTCCGAAGTTAACTTCGGAGATAACTCAATTGCCAACGCTGGAACCGAAACGGTTCCTGCGTGATCTGCGTAGTGGCAAGGTCAAGCAGATCT
GCATACTCTTCACAGAGGATGAGTATATGACCGATATTCGGTCGGCAACAGTATTTGCTGAGAACGAACGGGTTCTCAGCAGCTCATCGATGGACGAAAT
TGTCTTCGATGAGAAGACTCGAATTGAACGATACACGTCTCAATCTTTGGAGTCGCTTCAGGCAAATCCTTTGTATAAGAATTTAATCGAATTTAAGGAT
GTATTCCCTGAATCCGTGCCATGCGAGTTACCTAAGGACAAAGGCACTCGACATGAAAATGAGCTTGAACATGGCTCCAAGTACTGAGTCATGAAGCAGT
GGCCGCTGCCTCGTGAACAAGTACTAACGATCGACAAATTCTTTACCGATCGTTTTGCAGCAGTCCATGTGAGGGATTTAACTTTTCTTCACAGCTCCTT
GACCTTCTGTGTGCGAAAGGCCACAGGAGGATGGCGGATAGTGCACGCATTCAACAAGCTGAATGCTGCAACGATACCGGCTCAGACACCGAAACCGAGG
AAGGACGTAATCATAGATGGTATGTCAAAAAGTACCATCTTTTCGTCCATGGATCTGACGGATGGCTTCTATCGAATCCTAATGCGTGAACGGGACATCC
CGTACACAGCAGTGAGCACCCCTAGCGGTATGCTGTGGGAGTGGCTAGTGATGCCACAGGGGCTAAGTAACGCCCCAGCAACGTTCAACAGATGTTTAAC
AAATCTTTTGAGACCGGTGCGGGGTTTCGCACCGAATTACTTTGACGATGTGTTTGTCCATAGCCGGGCTATGGATGGGAAGACGGAAGTGGAAGTTCAT
AGAACACACGTTCGTCAGGTTCTTCAACTTATACGAAAGCATAAGTTGTATGCAAACCTCAAGAAGTGTATATTCCCTGCTAGCGAAATACCACTTCTTG
GGTACATCGTGGGTAAACAAGGCGTACGCCCTGATCCTGAAAAGATCAAGGCGATCACCGACTGGCCTGTTCCAGTCGATGTCAAGGGACTAAGAAAGTT
CCTTGGGCTAGCGGCGTACTTGCACAAGTACTCGCGTAACTACGCCGAGATGACTGTAAATCTTTCTTGTTTACTAAGAAAAAT