Description :
From Genome Similarity Track
Location :
Scaffold_227:4087- 10122
Transcript NameFunction/comments
g15406.t1hypothetical protein

Sequence
6035 bases(100 bases per row)
CCCATTTACATATGTAGGTAGATCTATATAGGTAGATCTACAAAGTAGGTACAAAGGCACGCGGCTAGCGTGTGCCTCGTTGTCATCCTGCGATTGGTTG
AAAGTGGGGAGCCAGACCCATTTCGACCAATCAGGTGTCAACCTGCATTTGAGTGGTTCACATGGATCCGAGGGCCACCCGCCCCGGTCCCAATAATAAA
CCAGAGTTGATTTTACCCTAGACTAAACACTTGGTCTCAGTATACCTGAGCTTATTGGACGCTTCCTCACCGCTACGTGTAAGCTAGTGACGGGCACTCA
CCTGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCCATGACCAAGTTCGAGATGAGTGAAGACCAGCCCGCCGGACCTCCAGTGATGACCCTGGAA
CACGCGGCCTTCCCCCATCTCACGTCTATCGAGTGGCAAGCGTTGCACCGGTGTCCGGAGAAACCGTCGTCACGTCGCTGCTGAGCTCAGCGACCCCCGA
CCAACAGCGCCAAGCCATCCAAGAGTTCATGGACCGCGAGCTCGCCGAAGCAAAACGGCGAGTATCAACTCCCTCGCATGCGTCCAGGAACAATGCCGTC
AAGATGGAGACATCCTCCTATTCTGGCGAGGGTCCTGATCACCTACCTCTGAATCGCTGGTTCAGAGAGATCGACATCGCGATCGCCTCGAGGCTAATCG
AGGCGCCGTCAGCCAAGGTGAACTTCTTGCTTTCCCGTTTGTCCGGAAAGGCCAAAGAATGGGCTCTCGGCAAACTTGTCGTCGACCAGTACGCGTTCCC
GACTCTGGAGGCACTCCAGAGCGACCTGCGTCTCGCCTTCGAACCACCGCAGGATGAGTCGCGAGTTCGAGCTACATTCTTCGCCCTAAAGCAAGGCAAG
ATGGCCATGCGCGACTACGTCCAGAGAACGCGACACCTTGCATCGTGTATCGTCACGAAGCCGATCGACATGGCTTCCCAAGTCCATGTTTTTGTGTTTG
GTATGTGCGAAGGTATGACGCGGTACTGTCTCACGCGCGCCGAGCCTGCCACGTTGGAAGAAGCCTTCGCTCTCGCGCTACGCGAGGACTACCTGGTGAC
GTCGTCATACACCAAAACGATGCCTGCGCAGACTCGGGTGTCGGTACCCGAGCCAATGGAGATCGATGCGACCGATGCTTCGCAGAATCGACGGTGGTCG
TCCTCTGGGAGAGGCCGCGGTGGTCATAATGACCTCTCGCTGAATTGTTTCCGCTGCGGAAAGCCTGATCATCGCGCGGCGGTGTGCCGCGCGCCAGCTC
CGATCCTCGCCCACATGAAGCACGTCACGCCCGACGAGAGGATTCCGGCCGCACAGCCAAAAAACGGCCGGGGCCAGTAGGTGCGGGGCGACCTACTGGC
TGGAACGGAGGTCCGGGTCCCCCGGCGGCAGCCCGACCTCCTAGCCCCCCTGTGCTCTATGCACACTTTAATGCCACCACTGCTAGTGGCGACTCGAGGC
TGATTATTGTCAGCCTTTATGTCGCCGGTGCCCGACGACCACTCCGCGCGCTCCTGGACTCAGGAGCGACGAACAATTTCTTCCGCACTTCATGCCTGTC
GATCCTACCCGCGGGTGTTCCCGTGCGTGATGTGCCTGGTGATGTCGTTGTCAAGCTTGCGGATGGAAAGCCGTTCCGTGTCGCGCGACGAGAAGTCTCG
TTGCCGTATACGTTCGACGGCTTCTGCAGCAATGACAACTTCATTGTGTTGGAGATGAACTACGCGTTTGACTGTATCCTGGGTATACCATGGCTGTCCC
GGTATCAGCCCCAGATCGACTGGTTAGCCCGGTCAGTCAAACGGCGACGCGACTTCGATGTGAGCGAAGTCTTCACGCACCTCTTGGTGGCACCAAGAGA
CTGACCCCATATCACAGTCGTGGACGGGACGTCCACGACGCACGTTGTGCGCAGAGCGAGCGATGGCCCTCTCTGCACGACTTGCGCAGTACTGCTGACT
GATGACGACAGCGTCGAACACCCGTCCGGTTACGGGCGCGCGAGGCGAGCGGTTGAGCATCCGCGGCTCCCGTATGATGATGAAGCGGTCGAGCAGGGGC
TCCCGTATGCTTTCGATACGGTCGAGCAGGGGCTCCCGTATGACTTTGAGGCGGTTGAGCAGGGGCTCCCGCGTGTTTACGAGACGGTCGAGCAGGGGCT
CCCGTATGACTTCGAGGCGGTCGAGCAGGGGCTCTCGCGCCTAGAGGAGGGTGAAGTATCGTCCGGCGACAGCGAAACATCGGTCTTGAGCAGGGGCTCG
AGACGCACGAAGACATCCCGACGGTCGCGGAGACGTTTGAAGCCGCGCCGCAGTCCAGTGGAACTCACGACGCCACCAATTGAGTCGGTCTGTGCAGTCG
AATATGTGGGAGGTGTTCCCAACCACGCTCGAATGATCAAGGTCGCGAGTCCACCTCGCGACGCCAAGTCCATCACGGACCTGCCAGGTCTCTCCTGGAA
GAGCTTCCTCCGGGATCTCAAGGCTGGTGACATCGAGCAAGTGTGCCTGATCACCGATGCCAACCCAGTGTCTGACGAGATGAACGCAATTGCCCATAAT
GACACGTCGTCGCGCCCGAAAAGCGCTGAACCAAAGTCAGCGCGCGAGGAGCGCTTCGCTGCGCAGTCGTGGAAATCACTGAAGGCGTCCGGCAATCCGG
TCTACGAGACAGCTCGCGAGTTCGCTGGACAAGATCCCTGCGGAGCTGCCAGCGGATCCCGGAGTGCGCCACGAGATTGACCTCGTGCCTGGATCGAAGT
ACTGCGTGATCAAGTCAAGGCCATCGACGACTTCTTCGAAGGCCGCCGCCAAACCGGTCACGTCCGTGAGAGCATCTCGCCTCACTCGAGCCCGACCTTC
TGTGTGAAGAAGTCTACTGGCGGGTGGCGCATCGTACACGCCTTTAACAAGCTGAACGATGCCACCATCCCGACGCAGACACCGATCCCGCGGAAGGACA
TCGTACTGGACTCCATGTCGGGCAGCGTCATTTACAGCGCCATCGACTTGACCGATGGCTTCTATCAGATCCTCATAAGAGAGAGCGATGTACCTATCAC
GGCAGTCAGTACGCCCAGCGGTATGCTCTGGGAGTGGTTCGTGATGCTCCAAGGTCTGAAGAACGCACCAGCCGCATTTAATCGCATGGTGTCCCATGCG
CTACGCCCGCTTCGTGACTTCGCTCCGAGTTACTTCGATGACATTTTTGTGCACAGTCACGCTGAAGAGGGTCTCAGCGCGGTCGACGTGCATCTGCGGC
ACTTGAGGCAGGTCTTTCAAGTGATGAGAGAGAACAAGCTCTACGCGAACCTCAAGAAGTGTGTCTTCTGCGCACCGGAAATCCCGGTGCTTGGGTGCTA
CGTAAGCAAAAACGGAGTCCGTGCTGACCCGGAAAAAGTGTCGTCTATTTGCTCGTGGCCACCACCACCAAACCTCACTGAGTTACGTCAGTGGTTGGGC
CTCACTAACTACTTACACACGTATACGAAGGGATATGCCGGCTTGATACAGCCATTGTCGTCGCTGTTGAAGAAAGACGCCACGTGGTCGTGGCGCCCCG
AGCACCAAGTAGCCTTCGACTCGGTGAAGAGGAGCTTGGCCTCGGCGCCAATACTGATGCTCCCAGATGACGCGAAGCCGTTCCACGTCGTCTGCGACGC
TAGCGACTTCGCTATCGGGTGTGCGCTCATGAAGTTTGACAACGAAGGCTGCGAACGAGTCGTGAGCTACCAATCACGACAGATGAAGCCGGCCGAACGC
AACTATCCCGTCCACGATAAGGAACTTCTTGCGATGCGACACGCTCTGATCAAATTCAGAGTGTATCTGCTCGGAGAACAGACGTTCGCGGTGTACACGG
ATCACGCGTCGCTGCGCACAGCGATGAAGTCCCCACATCTGTCTCAACGCATGGCACGATGGCTGTCGTTCTTCGCTGAGTACAACTTCGTCGTGCACTA
CAAGCCCGGCAAGAACAATATCCTCGCCGATGCTCTGTCTCGGCGTCCAGACTATGACCCACGAGAGACGCGGGGTCGTCAAGTGATTGACGAAGACGAG
GTTGACGAAGATCACTGCGCGATGTGCTTGACATCAGGTGTCAATCTGATGCACGTGACTCCAGAAATACCGCTACGCGAAGAGAACGCCGTTGCGTACA
ACGACGACGCGGTATATGCCGCCATCCTCGCACATCTTCTTTCCCCCAGTGATAAAACTCTCCGCGCGCTGCCGAACAACACGCGCAGCCAGATTGACCG
ATATCAACTCGACGGCGATCTGCTGACGTACAGCATCGATCGATTCGATGCTCCCCGCATCGTCATCCCGAACGACGATGATCTGCGCGCTCGGATCATC
CACGAGTTCCACGACAGTCCTGTCGGTGGTCACTTGGGCCGCGAAACGACGTTCGCGGCAGTGTCCCGCGACTTCTACTGGCCCCACATGTACAAATGGG
TGCGCAAGTGGGTCGAGTCTCTTCCAGCTTCTGGGAACGAAGCTGCACATGTCAACGGCGGCGCATCCGGAGACGGATGGTCAAACGGAGCGGGTCAACC
GAGTCCTCGAAGATGTCCTTCGAAGTTACGCGACTTCGTTCACCAGTTGGAGCTCCTTTTTGCCGCTTGCCGAGTTTGCGCTAAACAACGCGGAACACGC
ATCGACGGGTCTGACCCCCTTTTTCGTAAATAACGCGCGGCACCCGCGCGTTCCCGCTCTGCTCGCCGTGGGCCACCCCACGATGCCTCGTGGCTCCACT
CTGGGTGGGGAAGGAAATGATGGTGCTGGTAGTACGAACACAGACACACCGATACCGATACCGGTATTACCAGTGGTGAGCACGGATGGCACACCACCAC
CACCAGCTCCCTTGTCGAGTGCAGCCCACCAGTCCGTGACGCTGAATGCAGTCACCCGCTCGAAGTCGAGACGGACCCTTGCGACGCCGAACAACGCGGC
GTCTTCACTGGCAGATTGGACTGCGCGCACGTTAATCAACCCTGGCCCGGCTACCGATCCCGTCGCAGCTAACTACGCGCCGAAGCCTCCGGCGCGTCCA
GTCGATGATGCGGCCGTCTCTGATTTCGTGCTGCAGCGACAATCGGTCACCCGATTTGTACGAGATGCACTGCAAGAAGCAGTGGATAAGCAGAAGGAGA
ACGCCGACAAGCGTGGGCGCAAGAACGTGGCTACATTTACGACAGGAGATCGCGTGCTCCTGTCGACAGACGGCATACGCTCTTCGGCCGTAACGAATCT
TGGCGCGAGCAAACTCGCGCCGCGCTTTATTGGTCCCTTCAGGGTTACGAAGGTAATCGGTGATGCCTACACACTGGACATACCATCTTCCCTACGACTA
CATCCGACGTTCTACGTCGGGCGACTCAAGAAATACCACGCAGCTACAATCCCGTCGGCCCCGGAGCATCCGCCGGCGCAGCATGAACAGGACGTCCCTC
CCGACGTGCGCGCCTTGCCATCGAGCCATCCGAGCCATCCGTCCGCTCGCGCGGACGTGCTGCCGTCTGCGGCGCCCCGAACACGCGCCTTTCCAGCTCC
CGCGTCCGTTGCAGCAGTTCCGCACTCGTTTGGCGAGCAGCCGCTGCTGCACCCTCCGCCCGACGAGCCCGCTCCTCCGCCGCCTCAGCATCAAGCTGAG
CGTCCCGCGCCCAATTCACTGCCTCGTCCACGTCATCCTGGGCGACCAGGACGCGAGCTCTATCGTCGCGAAGGTCCCCCGCCGATTGTCGACTCGGCTG
GTGATATCCGCTGGATCGTGGACCGTATTGTGGAGCACGAGGATCCACCTCGTACGTATGCCCATACCCGTACGAGTACGCGCTCCAAGCACGCGGTTCC
GACCGCGCGACGTTACCGAGTACGCTGGCTCGGGTTCCCTCCAGACGAAGATACGTGGGAGCCTCGCGCCGCACTCCTCCGGGATGTCCCGGATGTTGCC
CGCGAATACGAGAATGCGATCGTGAACGAGAACGA