Description :
From Genome Similarity Track
Location :
scaffold_1192:4086- 6004
Transcript NameFunction/comments
g11142.t1hypothetical protein

Sequence
1918 bases(100 bases per row)
TGCTGTCTGTTCAGACACCGTCCGCCGGTGAAGATCGTCCTGTACCCTGTCGCGCTCGGCTCGGGCATCATCACGCTCAGCCGCGGCAGCATCTCGATCA
TCCAAGGCGGCATTGCGTGCAGTATTAACAGCATCGCGTTCTCCGAAGCCGGTATCGCGCTCAACCTTGACAGCCTCGCAGCATCGCGTTCTCCCAAAGC
AGCATCACATGTGATCTTCACGGCATCACGCTCAACCTTGGCAGCATCACGTTCTCCCAACGCAGCATCGCGTGTGATCTTCGCGGCATCCCGTTCGGTT
ATGGCGGCATCACAGTCCGCAATCGCTTGTACAAGTTGGACGGCGTGGGCAGGAGGGCCAGATTTAGCGACGCGGGCTTCTAGTTCGTCCATCCGTCTTT
GGAAGCCCGATCCAACATCCTCATGTATGCGTTGATGTGCCTGGAGCCGGTCTCACAGACACGCGATCTCCAGAGAATTGTCACGACGATCGGCTAATGC
GGACTCCGTCTCGGCAAGCCTAAGCTGGGTGTTGTCCAGATGAATCTTAAGGATATTGTACCTGCGCTGACAAATTTGACGAATGGAGCCGCCTGCCTCT
CAGCCTGAATCAATGCAGTCCGCACGGACGTGATTTCATTGCGCAAGGCCGCATGTGTGCGCTGGAGAACTTGGTGATCCTCCTGGCGATCACGGTATGC
CTCCGTCTGGAGCCGGTATGCCTCGAGCTGCCACCGAATGTTCTGGAGGTCCACAATGGATGACTGCAGCGAGTGTTCATCGATATCCACGAAACCTAAA
GCTAAGGTGGGAAGTGCAGGAGCCTCAAGTCGACGGATACCACTTACAGGAGGTGCCGTGATCTTCGTGGCATGGGGAACATCGCCGCCGGGGTTCTCTA
CATCATACACGGGTGAATACAGCATCCAAAGCGAAGGGTAGCGGTTGAGCACCTACGTGAGGCAGATGCGCGATCATCAGGGTTGAGATGAGCGCCTGGA
ACAGTTGGAGACTCGCCAGACACTGCTCAGGGGCAGACAAGTACAAGAGTGAGGAGGCCGGCGATTACATACTGGTGATGAAGAACACGTACTTGCGGCG
GCAGTAGGAGTCTCTGGAGGGCCGTCACGAGCGACGGGGCCGCCTGAATCCTCGGCAGAAGCTATTTGATGTCAGGAAGAGACAACAGTGGAGTCAGAAC
CGATGGACACGAGTCAGAGTGGAAGAACGCGTACCTGCGATGGACTCAGTAACAGCTGGAGCTCCCATAGGATCGTCAGACGCGCCAGGGTCATCCGAGG
AATGAGGGGACGCCATGAGAAACTCGATGTCCGCGCCAGAGGAAGCTATGTGGCTACGCACGGGTCCCGATCGCTGTACGAGCTGGCCTCCGCGCGGAGG
ACGATTGTCGTGGAGCGGGAATCTTGTTCTGTGAGAAAGACGGATCTCCAGGCAAGGGTACCACTTTTGTGGTAAACCGTCAGGAAGATCATGGTACCAA
GTTTTAGGTACCGTGTCGGGAAGATCAAGGTGCTGGGAATATCAAGGTGCAATTATTTCGATACACGCCAGGAAGATCATAATGTTCCAGAAGGATGGTA
CAATTTGTACTAAGTCCGATCTTGTAGCCAGTTCGTAAAGGTAAGGCTGGGAGCCGTTCGAGGTTTGAAGTACCGTGGAGAAAGGGTTAGAAAGGTTATA
AAACGGTGTGTTATTTACCCTCACGAGAGAAGAAGAGTAGCTTAAGCACTCAACAACCGAGAGAGAGAGCTTTCCCTTACAAGACACAAGCGTCCTACCA
CATTCCAGAGCTGGGAAGTACATTGGTCCCCTCTGACGACCAAGGATTGCTACAGTCTACAAGGGAATAGCGCAAGAACGCCTGGGTAGCTTGCCCAGAT
CGCCCCGCTCTCTCTCTC