Description :
From Genome Similarity Track
Location :
Scaffold_13:40859- 43294
Sequence
2435 bases(100 bases per row)
TCTGAGCCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACT
TGCCGGATCCGACCGCCGCCTTCTTCTGACGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGTTTGTCTGCGTCGGGAAGTCGTAACAGGGT
CAGCCTGTCGGCCAGATCCACGTCTCCCAACGTTTCGATGAAATGATCCACGTGTTCCCGCAGTATCTTGGATCCCCCATCCTTGATCTTCAACTTGGCC
CGTAGACCGGCCACATTTAGTCGATGTAGGTATTCCAGCGGGGATTCATCCGATCTGCCGCGAGCATGGTAGTATTGTCGTGCTACCGACACTCCCAATC
CACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAG
ATCCGCAAAGGTCAAACACTTCTCAGCATCTGACGCTTGATCTCTCATGAGGGCCGACTTGAATTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGA
TCCTTGCCCGTGAACTCCTTCAGATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCTGTTGCTACCACCG
CTGACGAAGGGGATGGGCCATCCAGATCATCCGGGTCGAACGCATCATGGGAGTTCTCTCCCTCCACGGACTCCATCTCCACGTCTCGTGCTCCATGGTC
GTGGAGCACTTGCGCTTGTGGCACGGGCGCTCTCATACCCTGCTCGGCCATAAACCGACTCATCACAGCTTCGAAGTGTCGCTGCAGGGTGCCCGAGGAA
GTGTCGGAAGAGCCTGTGGCCGTCTGGTCCACTGGTGAGTCAGGATCTGTGCGGCAATTACCTTGAGCCCGATCTGACGATAACTCCACTGGCTTCTTGC
CGGATCTGGCTCGATCCTGGCTGGATTGTATCAGATCACGGGTAGGGCGTACTGGATCCCGAGCCTTCACGTTCACAGGGACTTCCTGTCCCCGGATCCT
CGCCCGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGGGGCTCAAACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGCTC
GAGGACGCAGCTTGGCTGATCCTCGGCGACGTCACTGGATCCATAGTGCTCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCG
CGGATACTATGAGATCCAGGTCTAGCTCGAAGATATCATCTGCGTCGAACACGCCAGCCACGATGCCTGACTCCGTAAGCAAACATAATAGATCTTTGAC
TGCCACCAACTTGTTCGCCGTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCCGCATGGCATGATCTTGATGCA
GAAAGTCGCGTAAAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTTCGACTCTGGAGCTTG
CATCTTCTTCCGCGTAGTCTTACTTGTTTTTGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCT
GCAAATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTAATAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGCAT
AGAGAGGTTTTTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAG
CAGCGTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCA
AAAGATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACG
GAGGGGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCCCTCTCGGTAACTTCCGAAGAGTTC
AAGTGGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGC
GAATATTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGCTGTCCTTTAAGTCGT
ACTTGCCGCCTCCTGTGACGGGATCTTGAGAGTTG