Description :
From Genome Similarity Track
Location :
contig_46:40855- 42446
Transcript NameFunction/comments
g9567.t1RAW34794.1 hypothetical protein PC110_g8901 [Phytophthora cactorum

Sequence
1591 bases(100 bases per row)
CATGATGCGCCGCAAGCCCATGCAAGTGATCCAGGCAGAAGAGAGCCAAAGTGACCTACCTCGGTCACTAAGTTTGTTCGATTTGATCATGATTGGAGTG
GGGGGAACTGTCGGCAGCGGCATCTTCTCGACGGCGGCCTCGATCGTGTCCGACACTGCTGGTCCGTCCGCGCTCGTCAGCTGGCTCATCGGCGGCGTGG
TTTGCTGCATGAACGCCCTGGCGTACATGGAGCTCACCACACGTGTACCTTCGTCCGGCAGTACCTACGCGTACGCCTACCACGCCATCGGCGAGATGCC
CGCTGTGGTCGCTGGCTGGCTGCTTACCCTGGAGTACGCCGTTTCCGGTGCTGGTGTGGCACGAAGTTGGGCGCAGAAGGTCGAGGACTGGGTTGTCTAC
CAGCACCCGGACGCCGACGTGCACTGGCTCAACCTGGAGTACGCCAACCTGCTGTCTGCCCTCATCCAGGCGCTGTGCGTGGCCGTGCTGCTTGCCGGTG
TTCGCTTCGGTAAAGTTTTCGTGAACGGTTTCACGATCCTCAAGATGTTCGTGGTCGTGTTCATCATCATCGCCGGCTTCTGCGCCATGGACGCGGACAA
CCTCAGTCCCTTCGTTCCTGTGCGTTCGGAGAACAGTTCGGGCGACATGGCCTACGGCACGCAGGGTATCATCACTGGCGCCACCCAGGCCTTCTTCGGC
TACATCGGTTTCGACGAAGTCTGCTGTCTCGCCGCTGAGGCCAAGAACCCCAAGAAGGTCATGCCAGTTGCTGTGCTGAGTGTCGTCACGGGCACGGCTG
TGTTAAGTGTGCTGTGCTCGTTCGTGCTGTCTGGCATGGTTCCGTACGCGGAAGCCACGAGCTTCCCGGACGGCTTCAAGGGTGTCGGCTGGGACTGGGC
TTCTGAGATCGTCCGCGCTGGTGAAACCATTACCATGCCTGTGGTGGTGCTTATGCATTCCTGGCCCAGCCGCGTCTGAACTACGCGCTGGCCTGCGACG
GTCTCATGCCGCAGATCTTTGCCAAGGTGGACGCTAAGGGCAACCTGTTCGTGAACACTTTTATCACGGGTATCTTTTTCACGCTGGTGGCGCTGATCGT
GCCGTTCGTGACGCTGTGGGATATCGTGAACTTTGGTATTCTGGTGTCCTTCGTCCTGTCCAACTCGTCCCTCATGATGATCCGCATGTCGGAGCAGTCA
CCGCGCCTCGCGCCCAAACTCATCGGATCTTCGGTTGTGCTGGCACTGCTAACGGCCTTCTTCTACCAGCAGGGCTACGTGACCAACGACTCGTCGGCTT
GCCTGGTGATCGCGATCATTTGCCTGGTGGCGACTGTCGTTATGACAATCGTGCTTGCCATCAAGTGCCCGCAGGTTGGCAACGACCCGCTGTATTTCTC
GGCACCGCTTGTGCCGTACATCCCGATGATCTGCATTCTGGCGGACTTCTATCTGGTCGCTCAGATCAGCAACCTGGGTTTGATCCTCGGTGTCGCGTGG
GTGCTGGTTGGCGTTCTCTCGTACTTGCTCTACGGGCAGCAGCACGCTTCCAGCCGCAACGACTGGGCCGACCTGCTCCAGTACCACCTGC