Description :
From Genome Similarity Track
Location :
Scaffold_601:4085- 5714
Sequence
1629 bases(100 bases per row)
AGACGGTTACTACCAAGTCCTCATGGAACCGTTCGATGTTTCGAACACGGCCGTCAGTACGCCCAGCGAGATGCTTTGGGAGTGGCTGGTTATGCCCTAG
GGTCTCTCCAATGCATCCGCGACGTTCCACCGTCTCGTGACGCATCTCTTNNNNNNNNNNCACAGTCAAACTCCCAAAATCCATCCTGGGACCCAAGTCC
TCACTCTTACAGGGTTTTGAGCTCCAAGTGCGCGACCCCGCACAGGCGCGCGTCTCAGACGCAAAGGGAAACTGAGCGAGGCGATGAAGTCCACNNNNNN
NNNNTGTCATCGAGTGTCTCGAGAAGCGTCAACTCTATGCGAAGCTCGACAAGTGCATCTTCGGTGCTGACGAGATCCCGGTGCTCAAGTGTTTCGTCGG
GGTCGACGGGGTGCGGGCTGACCCCGNNNNNNNNNNTCGTTCATTGCGAGCCTTCGCCCAGACGTATTTCGACGATATTTACGCCCATACGAAACCCGAG
GCTGGGCGATATCTCGACGATCTCCACGAGGAGCATCTCCGGCAGGTCATTGAGTGTCTTGAGAAGCATCAACTCTATGCGAAGCTCGACCAGTGCATCT
TCGGTGCTGACGAAATCCCGGTGCTCGGGTGTTTCGTTGGGGTTGACGGGGTGCGGGCTGACCCCGNNNNNNNNNNCCACGAAGGACTACGCGTAGCTCG
CGCGTCCGTTACACGGTTGCTCAAAAGCGACGTTGAGTGGTCATGGGATGGCCAAGCAGAATCCGCTTTCCGAAAAATCAAGGAGAGCCTTCTCTNNNNN
NNNNNAGAAGGTCATGGCCATCGCGGAGTGGCCGCCCCCACAGTCGATAAAGGACCTGCGGAAATGGCTGGGAGTTGCCAACTACTTGCACAAGTACACG
AAGGACTTCACGGAGCTCGCGCGTCCGTTGACACGGTTGCTCAAGAGCGACGTTGAGTGGTCATGGCCAAGCAGAATTCGCTTTCCTCAAAATCAAGGAG
AGCCTTCTCTCGGCGCCGATCCTGGCACTTCCAGACGACACCAGGCCATACAGTGTCGTCTGCGATGCGTCTGATTACGCGATCGGATGTGCATTGTTGC
AAGTCAACGAACGCGGTCGCGAGAGAGTTGTCTCTTATCAGTCCNNNNNNNNNNTGCCGCTGCTCGGCCATTATCGCCGCGTTGTCGTCTCCGACCAGTC
CAGCGTCTTTGGCTCCCAGGCTCCAGGCTCGGTTCCATCGATATCACCTTTGTGATGGGCTCCCGAAGTATCAGGTCCAGACAGTGATCCCGAGCGTGTC
GTTGTCCCGCAGGACGAGGACTTGCGATATGTTCTCCCATACGGTGTCCATGACCCTCTTGGTGTGGGGCATCTCCGCCGTGAGAAGACGTATGCGCTTC
TCANNNNNNNNNNGCATGCGTCACTGCGCACAGCGATCCAGTCGCCGCACCTTGTGGTTCAAGATGTACAAGTGGGTCTCTNNNNNNNNNNGATCCAGTC
GCCGCACCTATCACCACGGATGGCGTGGTTGGTTTCTTTCATCTCAGAGTACAATTTTAAGCTCAAGTACAAGCCGGGTTGGCTGAACGTCCTCGCCGAC
GCTCTCTCTCGGCGACCCGACTATGAGAT