Description :
From Genome Similarity Track
Location :
Scaffold_9:408462- 409622
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G004194candidate a-L-arabinosidase

Sequence
1160 bases(100 bases per row)
GTTTACACCACTGGCCAGCCAGTCGAGAAGTTGATCTGGTTCCACCCGAGCTTCTTCTGGCCGTCCGCATAGCCCACGCGCGTGTCCACTGAAGATGCAA
TAACAAGCACAACACACACAACCGTAAGCAAGATGTCTAAAAGCTCACAAGAGAAGCCAAATGCCGACCGGCACTTACCGTAGTGGTAGTACAGAACGGG
TCCGTACTTGGGGTCTTGCATGACACCCTGACCACCTGGGCCGTAGACGTAGCCGTGGGACGCGAGCACCGTGGTGCCGCCTGACTTGGTGCACGAGACG
CCGTTCTTGTCGACAAACCCGCCGGTCGCCGATTTCGAGCGGCACGCCATGATCTTGTACTCGGCGCCCGCCGCCGGTCGCTTTTTGTCGTAGTTACAGC
AGCTGCCCTTGGAGAAGAAGAGGTAGTAGTACGATCCATACTTGAAAATGGTGGCGCCTTCCATCGCCGTGTTGACCGAATCGTACGCGATCTGGTACGC
GCTGCCCGATGGCCGGTTTGGTGAGCTCAGTTTTACCTGGTAGATATCTTTCCAGAAACTACCAAACGTAAGGTAGTGGGCACCGTTGACGTTGATGTAG
TTGGCGTCGATCGCATTGTATGGCTTCGTCTTGTCGCTCGAGATGAGGGCAGTTGAGTGGTCCGTCCAGGAGCCGACTTCCATGGTCTTGGACGTCGCGT
ACCCGATCGCGGACTCCTGAGTGCCGAACTTACTGATGCTGTAGTACATGTAGTACGTGCCACCGATGTTCGTAACATCTGGAGCCTATCAAGAGCAAAG
AAGCAACGCAAGTATACGAAATAGAGAGAGAAAAGAGTACGAGTGTCAGTCAGTTGCTTTTTAGGCTCCTAGTGGATGCACACAGCTTTCAAAGTTTCCT
TACCCACATGTCGTCTTTGCCCGTCCGGTTGATCTTGGAGCCACCCGTCATCGCGTTTCCCTTGTACGTCCATGGACCAGTCAGAGCTGGCGCCGAGTGG
ACCGCGATGCCTCCGCCCGTCGAGAAGCGAAAGTACGTGCCGTCCGTGCGGCGCACGATCGATGAGTCGTGGGCATTTACGCACACGCCCGTGCAGAGCT
TCGGGTTGGCGTAGGCGTCAACGAGACTTGCGAGCAGCGGCAATCCGAGGAGCAGCGAGA