Description :
From Genome Similarity Track
Location :
Scaffold_9:408420- 411369
Sequence
2949 bases(100 bases per row)
CCCGTTACACCTGGTAGCACTTTGTAGTCCGACCAACGACTATGAACATGTTGGATGATGAAGCGAAAGACTTCCATCCAACGCACGAGCTACTCCCATT
TGAGTCAAATCGAATGGGATGCGGTCGAACGATTGAGTTTTACGATAGGGCAAGAAGCCGTAGGCGCAATGTTGTCCACTCTGGGTCCAGACGGGCACCA
CGCCACCATCGCCAAGTTCATTCAGAATGGACTTGACGCTGAACGGGTAATGGTAGCCTTGCTTCACAAACAAGGGTCTCATCAGAAAGAGCTGTTGAGA
GAACAGAGTGCTCAACAGTTCGAAATTGTTGAGACAGCAGCAGGCTGCTGCCACCGGGTCAACAAACTCACTTCGACCCGAATCATTGAAGATTGAAATC
TCCAACTACAAAGCAGCTGAAGAAGATTCTCTGCTGAGATGGTTTGTTGAGCTAGATGACGCCATAATGGCCGTCACACCGTCGATGAGCAAATGCAGGT
CGCATTTACTCAGTAGAACTTGGCAGGGCGTGCGAAGACTTGGACCTTGAGCCTCATGCTATACGACCCATTTGTCTTTGGGTCGTTAGAAGTCTTCAAG
TCCCTGCTTAGTCGAACATTCGAACCACCGCGAGCTGAGTCCAGGGCTAGCTCTGAACTCCTGGAAATCAAACAAAGCAAACGTGATGTACACTCGTACA
TTCAGTACATACGTCATCTTACGAGTTGCATCACGTCCAATCCGCCGAATGGACAACCGTTGATCACGTTGTTCATGTAGGGTCTCACAGACGGTCCAGT
CAGGACCTATCTCTTCCGGTTGGAATTTGATACCCTGGAAGAGGCAATCGAGTTGCGGAACAAGAAGATTTCAGCATGAAACAAGCTCACGTGAGTTCAA
ACTCCTATCGTCCCCCGAGGCGACAGGAAAATGGAGGCCCAGAACCGATAGACCTCTGTTACGCTGAGAGTGAAAGTTCTCGCGTGACGAATTATAAAAA
GTTGTAGCAATGCTATGGATGTCAAAAACACAGGGCATTATGCATACAACTACAGTGCATTGAATGCCATACCACGTACCACAGGAAACAGTAACCGTCA
AGCAGCTAAGAAGGGTCCGAGGCGCGGGTATGACGCTGTTGCGAAAACGCAACACCATAACGGACGATCAAAAAACGTTCAGGGTCAGTAGGTGCGGAGC
ACCCTACTTATCCAGTAGCGTCAAGTAAATTTGTAGTCCTCTTGACGAGAATTGCTCCCTGCACGCAATCATTGTGTGTTACTGCATCTGGTAATGAGGT
TTCCCTCATTACCTTGAAGCTCGAAGTGGCAAAGTACATGTCACTACGAGCCCTAGTCGATTGTGGGGCGTCATACAACTTTATACTACACCAATCGCTA
GACAATAGCAAGTTCAAATACATTGAGCGAGAGATCCATCCAACGAGGATGACGGTACGCCTCGCTACAGGCGCATCCGTTACAGTGATGAAACGTGTAG
TAGGAATTTCCTATACACTGAAAGACGTCCAATACAATGATGACTTAATTGTCTTGGACTTGGATGACAAATTTGATGTTATCCTTGGTTTACCGTGGCT
CAGAAGGTACGAGCCACAAGTCAGCTGGCATCGACGAAGTGTCGATATGCCCGCCGCTTGTTCACCAGACGCCCATCTGATGAACGTCTTGGAGCGTCCA
TCACCATGTGAACGTATTACGAGTGAGTGCGATGGCTTCACGTGTGGTTCGGTCGTTAGTACGACTGCACAAGATCACAATATGACTAATCATCATATTG
CGGAGAAAATTTCTGGCGACTGCATAACAATTGCAGGAAGCGCCGAAGGCCCACCTCTCGAAAAAGTCGAGCGGACCAGGGCATGGTTGCCTCCTTAATC
GACAACACCCGGATCATGACCAACCGATTACCAATGATGGTCAATACAGAGATGGAATAGCCCAAGAGTCTAGAGTTGACAGAATAAGTCCACAACAAAA
AGTGGAAGAGATTTCCCATGAGAGAACAGATACATTGAATGTCCTGGTAATGACGGATCAAGCATAGATAGCCATATGCTTGATCTGATCGCGCCTTCAA
ATTACCTTCGGAGATCATTCAATTGCCCACGCTCGAGCAGAAAAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCG
GAAGACGAGTACGTAACCGATATTCGGTCGGCAATGGTATTCGCTGAGAAAGAAAGGGTTTTCAGCAGCTCATCAATGGACGAGAGTGTCCTTGATAAAA
AGACTCGGATTGAGCGATACACATCCCAATCGTGGGAATCGCTCAAGACAAATCCTCTCTACGATGATTTGATGGAATTCAACGATGTGTTCCCAGAAAC
AGTGCCGTGCGAGCTACCCACGGATAAGGTACTCGTCACGAGATCGACCTGAAACCAGGTTCAAAGTACTGTGTCATGAAGCAATGACCCCTGCCTCGTG
AACAAGTACTAGCGGTTGACAAATTATTTGCCGATTGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTTTGTTTCTG
AAAGGCCACAGTAGGATGGCGGATAGTACATGCCTTCAACAAGTTGAATGCTGCAACTGTACCGGCTCAAACGCCGACACCAAGAAGGATGTCATTAAAG
ATGATATGGCAAGGAGTACCATCTTTTCATCGATGGATCTGATGGACGGGTTCTATCAGATCCTTATGCGTGAAAAGGACACTCCGTACACAGCAGTGAG
CACCCCGAGCGGTATGCTCTGGGAGTGGCCAGTTATGCCACAGGGATTAAGTAATGCCCCTGCCACATTCAACAGATGTGTAACGAATCTATTAAGATCC
GTAAGAGAGTTCGCGCCCAGTTACTTCGATGATGTGTTTGTCCATAGCC