Description :
From Genome Similarity Track
Location :
Scaffold_19:40834- 48721
Transcript NameFunction/comments
Phyag_g557hypothetical protein
Phyag_g558hypothetical protein

Sequence
7887 bases(100 bases per row)
TAGCTCAGATGGCGGCCTTGTGCGTCTTCCAACGCCTCCGTCcacgcatctgctgctggctgtgcaCCACGACCGATACGCACAGTTGCTTCGCACATTT
TTAGCGTGGAAACGACGTGCCCAGACGCAGTGTGTGCGGAGACGAGTACGAAGATAGCTCCGTTTTCCATCTCGATTGATGCTTTGATACTAAATAATTC
GTGACGTCCATTATTACAATTAGCGTACCGCTGCTGCGTGTCGAGTAGGGGCAACTTTCTACCAGCAAATCTTTTGGGAGAGATGGCGAGCTTTCGTAGA
CCACagacgccagcaccaacaggaaacagcagcacagtcaaaagaagaagaaacgcatGAAGAACAACCCCCCGAGGAGCAAGCGAGCGACGGTATTGAA
CTCGGCACCAGCACTGAAAGGAGGAGTGAAAATGTGGCTGTTTCTGGCACCTACGatgatgaacaagaagatgacagcAAATATGGCAAGCAAGATGATG
CCATTTTGTTACGCAAAAGGCACCTCTTCAAGGTGAAAAGATTCTTCAATTCTGATTGTTTGAGGCTAACATTTAACTTATTAATTTATTTTGGACAGCG
GTGGAAGCTTAGCCTTGAGGATAAGGCAAAAACTTCTCCAGACAGAGTTACTGCAGTTGTGCGGATTCGCTCGCTGCACGCAATTCGGCGTTGGCGAGAC
TTTGTACGGCTGAGAAGAGATCGCTCTGACTTACAACAACGTGCCTATTTCTTCTTGTACTACTGGCTGCTCAAGCGGTCATTAAATCGTCTTGGAAGAC
ATTCGTTGATCAAGAAGCGAGAACGTACGCTAATTGTGAAAATTATGAAAGCGAATAGGCATCACCTGCTTGTTAACGCAATGCAGCGGTGGCGACTACG
ACTGCGGATGCATCAATCACTAGTGCTGTGGTGGAGCTACGTGCAACGGCGCCGACATCAGAAGCTACTGTATCGACCGATAGCAGACGCTCTAGCCCGG
AAAACTCAATGGCGTCTCTTACGACTCACGTTTGATGCTTGGGGAAAACAGCATACGCGCAACCAGGCGCAGCTCATGCTTCTGCATGTTATTGACCGTC
ATGTGTACCGCAAAGTTTGTGCAAGAGCATGGGGTACGTGGAAAatccacgtgcagcagctcatggatCTCGATACTTTTCAGCGCGGCTACCAAGAACG
CAGGTTGCGATGGGTATGGGAAGTTTGGAGCGCTAAGACACGAGAACAAGAATACCGGGAACAACAGCGGCGCTGTGCAGTGCGAGCTTACTATTTATCA
CTTTTGCGTAAGGGATTCGACGGATTTCGAACTTGGCGTATCCAGCGACAGGTTGCACTAAACAGAGTGCAGACTAtgcaagatgcagcagatgccAGAA
TAATGGCGTCTGCTTTCTTACGGTGGGATCATTTCACTGGCGCGAGGAAATTGCAAGCACTCAAATTCGAGCGAGCTGTGCTCCATTCCGACTCTCGAGT
GTTAAAACGTATATGGTTGAAGGGATTCCGGTGCTTCTTTTCAAACACAATAGAGAAGAAAAGGCTGTTGCTGGCCGCACAAGAACATCATTACGTCCGA
ACAATTAGGCGTAGCTTTTGTATGTGGAAAGATGTGTGGCGAGCCGAGCACAACCGTGAACAGACATACACTAAAATGCTTCAGGGTTTTAAGGTGGCGA
AGGAGCGAGCTGTAAAAGCAAGGGTGCTGGAGAGCTGGTCCGAGTTTACTCGTGCAAAGGCTGCCAGAAGAGTCGTAAATGCCCAAGTCCGGGGAGAAGC
ACAACGTCGTATGCTCCAGAAGTACTTGGCACAATGGGTTACGTACGTGTCATTGTTGCGGTGGCAGCTAATTACTTGCACACGAGCGGATCAACACTAT
AGAAGCATAATTTTGAAGAAATGCTTGGAGCGGTGGCGAAGCAATATTGTTCTGCGTCAGCGTTACCGCAACAAGACACGTACCGCTCTGGTACATTGGA
AATTGACGTTGGAGCGCAAGGCATTTGACGGCTGGAAACAATACTTGCATGCCAAAAGAATGAAACAGCACCGCATTCACGAAGCCCTGGAGTTTCGCCA
CCAGGAATTTATTCGTGATGGTCTACGTCATTGGATGACAGGTGCACTGCATTTGCAGGAACAGCGTGAGCAACGGGTAGCGCTTGCTCAGGCAAGTAAC
ACGACTAACGTTTGGCGCAGGGTTGCAGCGATAGCTAGACACTGGCGTTACTTGACGATTCGGCGCCGAGCTATCAGCGAAGAAGGCCGAATGTTAGACA
GGTCAAGAAATATAccgcgacgagttcaagatGATGAATCCTGGCGAGTTGGATACCAGCAAATAGAACGCGTACAACACAAAAAAATGTCAGCCCCTGG
TGCAAGACAGGGAAGAGCATTCAAAGAGATCAGTACGTTCCCAGACGATGCAAGAAGCTCAAACTGGGCGATGGAGCGATCCCCACTGTCAGAATTTGTG
TTACTTCCCAGGAACCGACCGCAACCTCGAAGACCAGTTGAGGTTCTGCTGTTTTCACAAGTAGAAGCAGATAATTTACCACGACCTAGCGAGAGCGCAG
GTATGCACGAAAACCTGCGATGCGGCTTTGAGTTTCCAGCTGAACCTTTTGCTCCTTTAAACCCGCCACCGGAGTACGATGTCAAGCCAATCAGTCCTAC
TTGGAAGTTCCCGCCTAGTCCCTCAACGGCCGTCAGAGAGCGGAGAAGACATCGAGATTTACCTGCTCATACTTCAGCAATGCCACCTAGGGAATGTGGT
GATTTGCTTCTACCAAGAACAACGGCAGCGCAGttggacgcgctggagcaACAGCTAGTGGCGTTAATCCACCGGAAAAAGGAGTGGAAGGTgtcacagc
aacaacttgaGGCactgcgtgaagaagctgcgtcaaACCCACGCCTTCAAGTGAAACTACAtatgatggagaagcagcacgcggATCGTACGAAGCAATG
GAGCCACACGAAGACACGCATTCGTTCTTTAGCATCCGAGATCCAGCAATTGAGAAGTGCGTTACGAAGATGATGCTACTGGCAACGTAATGATAGTCCT
CATCGCAATAGTGCTTCGTATTCACTTATGAGTGTGGAGCACCTGTCAAAGGCAGCCTCAAAGTCGGCATCCTCCATACCGTGCTGTTTGTACCAGTGCA
CATACGCATTGGCGTAGAATTGGCGCTGAGCTCGTTGTAAGAAGTGCTTTGTGCTCGTCAAGAAATTACCATTGTTGACACAGATTGTTACAGAAGCCTT
TGCTTGCAGCGATGGAAATGGTGCAGACTTTGAGTAGGTTAGCGTGCCTTGCGACATCGCTGCTAACCATGGCACAGGGGGGAATGCGGTCTGAATTACT
AAACCAAGTTTTTCGGAAAAGCGACACGCATCAGTTGGAGAAGGATAGATGCCGCGAACGACTGTAGTCGACGCCATGCTTGCGTATAAACTTCGTGGGA
AGGATGCAGCTGTCTGGTGCACAAGCTTCTGAAGGATATCGAGAGACACACCGGAGTCAACAACCTGTTCATGTCCACGCGACAGCGAGCGCACTTGTGC
GACCACCGGAGCGTGAAACAAGGTCGCCGAGGAGACACCTTTTGCGACCGGCATCTTGGAAGTGACTTTGCTGCGCACACCCGACCCAACACGATCTCGC
CACACCCCAGAACGAACATCGAGAATCTTGGCCGCAGGCATGGGGCATACTtcacgcagcaacttgccgaGATCGAATGGCCGCGAGGTGCTAACATctc
ctgcagccgctggGAACAACAGCCCCGCCAGATCTGCAGCCGCCATGCTGTTAATTTCTGCAAGCGACACACGTTGGTTCGAACTGTCAGTTCCCACTTT
CTCGTGCACGACAGCTTTCCAGTAACCCGCGGTTCGCAACAATTCATCATTATCCTTGTAAATGACAGCATCTGCAACCTCTTGAAGGCACTGCAACGTC
AACACAGCATTATAGTTCTGGAGCGGTGTGTCTCCACGTGAACAGGACGGAGCCACCGATGCAGTCACTAAATAAGCCTTCGGATACGTATCCCGCATGT
TTTCCAGTACTCGGCAGCCCAATCCTGAGCCGGTTCCTCCACCCAGAGAGTGCATCACCACACTGCCTTGGTAACAATCCACAGCTTCAATCTCACGACG
TAACGAGTCCATGACTAACTCCACCAACTCTCTGCGTTCATCCAGAGCGAATGACGTGAACACCGGTGCAGGAGCTTTCAATCTCGGTCCATAGTATCCC
ATGGCCCAGTTGTtgcctcgtccagcttgttCCACATGTGTATGAGCTGGCAGATAAGCTCCAACACCGTCATTTCCAGCTTCGCATACCGAACGAACCA
CTTTAGGCTCCGAGTCAACGAGAATGCAGCGAGCAGCTTGAGTTATTGGATGGAAGAGGTGTCGCGACAATGATGCAGGCTTTTTGGGCGCGTTTGCAGC
GCTGGTTGAGCTTCCTGAcgcacgacgaagctgctgagacACACCTGCGTCCTTTCGACTACGATTctcatcttgagcttctccagaAGCAGCGGCCAAG
CGCCAGTACGCGCCGCCCACCTGGTTGCCACATTGGCCGACGTGCACATGCACACTCATGGAGGTCGAAGAGCTCAGACCGCACGTGATTGGTTGCATTG
TGTTACTTCAGCGTCAATGCGTGAAGTAAGCATCTTCGTACTGGTCAAATACAGTTCAAAGAGCTCCAGGACCAGTACGATGGCGTCTACAGTGCACGAC
GTCGTGCCGTTTGAAGGGTGCTTCCCGTCATGGGAAGCCTTCGATGTAGCGCGGAAGTCTCACGGTGAGAAGACATACACTATGTACGTGTGCCGTAATA
CGGTGAAGGTGGCAGTGGCCAACAAACGCCGTAAAATGCAGGTCCCCGAAGCTTGGGTCTATGACCGCAAGGTGCGTCCACCTCTAACAAAATAACGTCC
ATATTGTAGGTTTTCATAATAATATTGCCTTGTCCACCTTGCTTTTGTCCAGATTTACGTGTGCACTCATGGCTACAAGCGAGTGTCGCGGTCTAGCGGC
TCACGTCCACGACAGAATGTCCGATATTCAGAGTGCAATGCTCGTTTTACGGCTTGTGTGGTGAGCGAAGTGTTTGAAGAAGGACGCAAAGCCTTTTTCG
TCAAGGTAATAGGCCAACACTTGGTACACACCGACCACCCCGTGAATCTGGAACAGTGGCAAATGTACTCGCAGAATCGCGCGGCTGTGATTGAACATCC
CTATCTTACGCACGAAGTCGAGCTCATGCGTCGGGTTGGATCCAACAAGAGAGCTGCACGGGATCATATAGAGACATTAACGGGCAAAATTTGCACTATG
AAGGACATGCACAACTTGTATGCGAGattgaagaagcgcgagaagaaTTCGCGTCCGGTGGACGCAGTACGGTCCCAACCTCAACGGACGACGACCGGAA
TTTCCTCAGATCTAGGTGGTTTGCAGAGCGCGACATACGCCCCTAATGTTAGCGCTAATGGCGCTAGAGTGGAGtctgtgctgcagaagttcGTGGATGC
GGACGTAGAGAACCACGTCAGCATCTTGTCGGGCGATGATGGCTCGAACGAGTCTATTTGTTTGGCCAGTAGAGCCATGAAAGAACACTTCCAGGTGTTT
CCGGAGCTGATGATACTGGACGTGTCAATGGTGACCCCAGCAAATTTGCAGGCAGGGCAACAGTTGCATGGGTTCTTGGTTATGGATGCGCTGGGCAATG
CCAAACCTGCTTTTTTGGCTCGGTCGACGGCTATGTCGCCGCCATTGCTTCATCGAGTGTGCCAAGATTTCAAACGCACGCACCCGAAGTGGAAGCATAT
AAAAGTGCTGGTTATGAACAAGCTATTACCCGACGTCATACAAGTATTGGCACGTGAATTTCCAGGGACGCTAGTGTTGCTGTGCCAGTACCacgtgctc
cagctccttaATGAGCTCCTAGCACGTTCTCAAGCACCGGTGTCGATTCAAACAGCAGGTTCCAGAGCTGCGATAGCTGACGCCGCGGAAGAAAAGATTA
TCGAcgcactccagcagcttgtatTTGCGCACTCCGAACTGCGATACATCGAAGCAAAGGTTTTGTTGACGCGACAACTAGTTGCTGGGGGCAGAAAGGA
GCAGCTTGCAATTTTTGACAGAGTTTGGGAACCGTATCGCGCGTGCTGGACATCTTACGCGCGCACAGAGCATTTTGACTTCGCGTCATTCTTTACAAAA
GGCGTGAATAGCTTTTGGGAACCGATGAAAGACATGTTTAAACGCGCCGGCGACGATACCACCGCAGAGGTGCTCGATCTACCGCTCCGGTCAGTCGCGA
ATAATGGTGTTGCCAGCAACACGATATCCTTGATCCGTGATGGAGATAGAAAACGATGTTCTAGCGTCAACACACTTGTTCAGTGCACTTCTGAGGTGCT
GAGGGTGCTGAAGTTTGTCGAGGGCGAGTGGACATCTAAACTGTCGATGCTGGAACTAACCAAGCCTGTTGCAGTAGATCGTCGCGACGCTTTGCTGCAT
TTGATGGTCAATTGCCTCAGTAGTTTCGTGGTGGACCTGATCAGTTCCCAGCTTACAGCCCAAAGTGCTCGTGCCAGTGGGTCTGTCGCCGTCACCAAGA
CTCGAGCTCCAAAATCGTATCATTCTCGTAGCAGATCTGAAGACAATgaagtggcggtggtggcgtcTGCGGAAGCGACAGTGCGCTGGTTGAACAAAGC
GACTCGTGAGAAGCATATCCTGCAGCGCGACGGAAGCGCTTGCGACTGCAAGTTCTTTGCGCTGTACCATCTACCATGCCGTCATTTGATTTGGTACGAA
GTCGTCTCTCTGCAACACAAGCAGCTCAGTTTGGTGGCGGTGGGCCCTCGATGGTTCCTGCGGTCGTTCCAGGTGCCGAAGCTGAATAGCCTGCGCGAGT
CCAACGAGATCGAGTATCACTTGCTGTGAAGTTGGTCACCCGTCGATTAATTGCGATCGCCGGAAAGGgtccatctccatcatgTCATCGGATGATACGC
AAGGTAATCAAAATGCTTGCTTCAGCGTGTCTCACGGCAGCTGCCCATCTCACGGGGGTACGTACCATTGCCGCGGGCCGAAATGTGCCGCCATTTCGCC
ATTTACGGCGCTGTCAAACATCTTTTTACGCTTGTGCAGGCTATTCCACGCGCTCTGTGACGTCTTTGTGTGCGCTGACGCGTGTTCCTGGCTGCTTGGT
AGCATTTTGCAGAGCGCAATGATCTATGCTGGTCAAGCGGCCACAAAGACTCGCAGCGGACAGTGTTAAAATCGTAGAGCGAAATCTTCCCCAACCATGA
CTGGTGGTCGATATTGTCCGGCTGGCCGCAGACGAAATGCACTCAAACACATTGCTCGTCAGATCTCTGAAAGCGCACGTCAAATGCGGTGGGGAGACAA
ACAGAGAATACATGAGATAAACGGTTTGTTGCTACTGTACAGTAGCTACAACACCCGCCCCGGGCCTCGTCGCCGTAGAGTCCTCTCTGCGCACCGCTAC
GTGACGAGCAGATCATCCAGGCAAAGAGAGATCGTGTCGCAGTGAGGAAAGTTCTCCTGGGCCTAGGTTTATTAGCGTGTGTGCCAGCCTGGCACGACCA
GGCTCACGGACCGGCCGACGCGCGAGACTGGAGTTTAGGGCGGAAAAGGAATCGCTTCGATCACGCCGAGCTCGAACTTCGAGTCGATCACGAAGTGCAT
GTCGGTAGACACATGTCGGTAGGAGATTCTTCGCCGGATTGCGCAGCTGCAAAGCCTACCGACATTGTACCGACATCCGGATCGTCG