Description :
From Genome Similarity Track
Location :
Scaffold_379:4083- 6422
Transcript NameFunction/comments
Phymu_g9276hypothetical protein PHYSODRAFT_521725

Sequence
2339 bases(100 bases per row)
TTGTCAGGATAGAGCGTCCAGTAATGCTCCGATTCTCGACTCAGGTCCTTCGTGCGATTGACGTCGATTTCCCCATCGTCCTAAGGCCCCACCGCCATTT
CCACTAGGGCTACCGGCTTCTTTCCGGCCTTCCACGTCGATCTTGAGCCAGCGAGTGGACGTGCCGTTGGAGAAGTCAAACTCCTGGATATGTCGAGTCC
GAACGCGCAGTAACGGAGCTGGGGTCATCCCACCCCCTCCCGAGTCTCCAAAGCGCtccacatcgtccagcagatgaaaggagaaggcgctgaacACGGT
GATGAGGAAACGACTGGGCCGTTCGGGGGACACGTCGATCTCAATCGGTCGCCCCCGAGCTTCTGCAGGCCGAATGATCAAGTTCGGGTTGCCCAGTAAC
CGATGCACCACGAAATACGAGTCGCCACCACTGATCGTCCTTGCACAAGCCTGCAAGAGAGCGCTGACAGCTCGCACGCGCTCCTCCGACGCAGCCGCGA
ACCGTTGGATGTgggcgtccagcacctcgaagATGTGTTCGAGTCCTCGGTTCTGCTGCGGCTGGCCCGTTGCGTCTGTGCTGCTCTGTTCaggctgttg
ttgttgttctcCACCACCGTACAAAGTGTCGTTGATCAGAAACAGCTCCGGTAGAATGTCACGTAGAGTTTGTTCCAGGGAGATCGGTTGGGGCCTGGGC
AGGAAGATCTGGGCGAAGGTCTCTGCATGACGGGAGAAGATTGCGAGGTATTCACTGCGCGTTCGAGCCCTGGCCGCTTTCTTCCGGATCGCAAGTTGTT
CTGGCGGGTGGATCTCCCACAGTAACGGGTCTGTCTCGCGCAGGTACTGGACGCTGCCTAACTGTTGGTACGATGCCGTCCAACGCGCATTCGTCGTCCG
TAGCTCCTCAGTatcagcgtcttccacgtcttggcgctccttctcggctGAAAGCGAcagagaagctgctgctagaGCCGCTTTCGTGGCAGTCGGGGAT
CGGAACCGATAGAACGGggtcttgcgcttcttgtcggGCATTGTAAATGGTCCGAAaaaggaggaagatgaaTGTGCCGGTaaagttgaagaagaacccg
cAGAAGCCGTCGCCAGCTTACAGTAAAACGACGCTCGATTGAGCGCTGCTACCCACGCACTAATGGATGCTTCGGTCTCATCTACGACGCGTAGCTCGAT
GGATTTCCGCCTAAGGATTTCGCAACGAATTAGCAAACATGACGAAGTAAACaaacaaataaaaaaacacGTACGGGCGCACTTGGTGTGTGAGTCTGGC
GGAGAACTTGAGCActtgaaggcgacgatgaGAACTGGCGCTAGAGATGCTGAAGGCCATCGCCTGATCCCCACGGCCTCTCTGCACAAGAGCGTGATCT
AGAAGAACAGCGCCACGAGGAAGCCCATCGGCCTCACTAGCGAAATAATACAGGCGGTTCCCTTTGAGCTCGAAGTAGCGTGGCTGCCATGAGCTGCCCA
GTCcgtgctgcttccgcttcttcttcttgagccaACCGGTTTTCTCTGGTGCGAGGTGAGCTACTGGGTCAGTCAtactgtcgtcgtccgttATGGGGAA
TTCTCCCTGCATTGACGCGTGCTCCGAGGACCCGGAGGGCTGAGACGAAAGCGACAACATGGACCAGGACAACGGAAGCGCCGACACGGGTTCATtgccg
tcttcctcgtcgtttTGTCCTCTGTCTGTCGATTCCTCGTCATATTGAACGGAGTTTTCTGTCTCGTCCGTCTTGACTGCTAGTTGCGCTTGTTGGGCTC
GTAAGACGTCGATATCTTCCGCCACTAGAGTGCTAAAGGGGCTGGTTTCAAGCATACTGCTATTGGCTACCCGCGCGTCTTCATTGTCGCTTCTACTAAG
TTGAATCGGAGACAGGGGAGGCCGAAGCGGCCGTGGttcgacgtcttctgcatTGTCTtctacgtcttcttctcctaGTTGGCTGGTTAAAGGCGGTGAC
GTCTCTGGTTGATCCACCGCTTCCGAGACGATCGTCTGCTTCGAAACTTCAGCCACTGCCTGGTTTATACGGTGAGCCAAAGTGATATGCTCTGCGTGGA
GTTCCCCCGACCGAGTGAGAGGCAGCGACACTGTAACAGCCCAAAGCTGCCGCCCAATCCATTGCAACGAGACGTCCGGATTGATAGCTGACGTGTTGGC
AGCACTTGAGGTGCCCGTCCATCCCGAGACTACGCGCGCGACCTTGGAAACGatcgcagctccagcctccATGGTCCAACACGTGATACAGGccttgaag
aagtcgtccTCTCGATACCAGCGCTCCACTCGAGCTTGG