Description :
From Genome Similarity Track
Location :
Scaffold_292:408281- 409583
Transcript NameFunction/comments
Aphin_H310_08675Chromodomain-helicase-DNA-binding protein 8

Sequence
1302 bases(100 bases per row)
GCGAGTGCTCAAGCAAATGCGCGTGCTCAACGTCGATCGGAAGCTTCTCTTGACTGGCACGCCATTGCAAAACAACACGCAAGAACTGTGGGTGCTGTTG
AACTTCTTGGAGCCCGTGATCTTTGACAACATGGAAGAATTCAACGACAAGTACGGCCGGTTGCATTCCCAAGAGCAAGTGATGCAGCTCCAGCGCATGC
TCACGCCATACTTACTGCGCCGCGTGAAGGAAGATGTCGAGAAGAGCATTCCACCCAAGGAAGAAACGATCATTCAAGTCGAGCTCACGACGCTCCAAAA
GCAGTACTACCGAGCGATTTACGAAAAGAACCGGTCATTTTTGTACCTCGGGACGCAGAACGGGCTGCCAACGCTAAACAACTTGCAACTTCAGCTGCGC
AAATGCTGCAACCACCCGTTCTTGATCAAAGGCGCGGAAGAGCGCGAATTAGAGGCCCTCGGCGCCGCCCCAGACCCGGAAAAACTTATGCAAACGACAA
TCCAAGCCAGCGGCAAGATGGTACTCGTGTCGAAACTACTGCCCAAGTTGAAGGCCGAAGGTCACAAAGTTTTGATATTCAGCCAGTTTATTCGACAATT
GGACCTCCTCGAGCGGTATTGCGAGCACGAAGGGTTCATTTATGAGCGCTTGGACGGATCGAGCATGGGCACATCGCGCCAAGCAGCGATCGACCGGTTT
TCCAAGAAGAACTCGAAGTCGTTTATTTTTTTGCTCAGTACCAAGGCTGGTGGGGTTGGGATCAACTTGATTGCTGCCGACACGGTCATTATTTTCGATA
GCGATTGGAATCCTCAGGTATGTTTCATTCATTCCGTCCAACACGCATAGTTCGGTTGTCTGACAACATCGCATGAAGAATGACTTGCAAGCCCAAAGTC
GCTGCCATCGCATTGGACAAAAGAAGAGCGTCAAGATTTACCGCCTCGTGACTCGAAACTCGTACGAGAGCGAAATGTTTGACCGGGCGTCGCGCAAGCT
CGGCCTCGAGCACGCCGTGCTCGGCACGGGATCGTTTAGCGAATCGCACGACATGGAACGACCGTCTGCGGAGATGCTTGTCGAGCTGCTGAAAAAGGGC
AAGGAGTTGCTCACTTCGTGTCGGAACAACTCTCACTTGGCGGATAGGAGCGTACGGTCTCATGGATGACGACGACAGTGCGTCGCGATCGTTTGTCGAG
CGAGATATTGAAACCATCTTAAAAGAAAATGCGCACGTCCGAATCGTCAACAAGCAGTTGGATGCAGTTGACGAAGAAGGCGAAGATGGCGACGATGCCC
CG