Description :
From Genome Similarity Track
Location :
scaffold_199:40826- 45422
Transcript NameFunction/comments
Pl_107841T-complex protein 1 subunit zeta
Pl_107842hypothetical protein PHYSODRAFT_284638
Pl_107843T-complex protein 1 subunit zeta
Pl_107844FAD synthetase, putative

Sequence
4596 bases(100 bases per row)
CATGAGCTACCGCGGCATGAACCCCAACGCTGAGATCGTGAGCAAGTCACAGGCGCTCATGGTCAACGTGAGCGCCGCCAAGGGCCTCCAGGGCGTGCTC
AAGTCCAACCTCGGTGCGTCCCTTTAACCAACACTAAAGATCTCCTTCTAACATTCTTTCCATTGTGCTCAGGCCCGCGCGGTACACTCAAGATGCTGGT
AGGTGGCGCCGGACAGATCAAACTCACCAAGGACGGCAACGTTTTGCTGCACGAGATGCAGATCCAGCACCCGACGGCGGCGCTGATTGCGCGCGCGGCC
ACAGCGCAGGACGACGTGACGGGTGATGGCACTACGTCCACAGTTCTGTTCATTGGCGAACTGCTGAAGCAGGCGGAACGCTTCCTGGCTGATGGTCTGC
ACCCGCGAATCCTGTCGGAAGGCTTTGAACTTGCCAAGGACGAGGCGTTGCGTGTTCTGGACGGTATGAAAATTACTCCTGAGGACATTCTAAAGGACCG
CGAGCTGCTTTGCAGCGTCGCGCGCACCTCGCTGCGTACCAAGTTGGACCAGAAACTTGCTGATCAACTTACGGAGATTATCACGGATGCTGTGTTGACT
ATTGCCGTGCCGGAACGCCCTATCGACCTCCACATGATCGAGATTATGCACGTACGTGGTAAAAAGTTGGTGGTATTTTATTGAGACTGATGTTTCTGTT
TTTTAGATGATGCACCAAAGCAGCAGTGACACTCGTCTTGTGAAGGGTCTAGTGTTGGACCACGGCTCGCGTCACCCGGACATGCCCACTTCGCTCGAGA
ACTGCTACATCATGACGTGCAATGTGTCGCTCGAGTATGAGAAGAGTGAGGTGAACTCGGGCTTCTTTTACAGTAGCGCTGACCAGCGCGAGAAGATGGT
GGAGGCTGAACGCAAGTTTACGGACGACAAGGTACGCCAGATTATTGAGTTGAAGCGCGAAGTTTGCACGGAGGAGAACAAAAAGAGCTTCGTAATCATC
AACCAGAAGGGTATTGATCCCCTGTCGCTGGACATGTTGGCGAAGGAGGGCATTTTGGCTCTACGTCGTGCCAAACGCCGTAACATGGAGCGGATAACGC
TTGCTTGCGGTGGTATGCCCATCAACTCAACGGACGACATGGATGAGTCCATGCTGGGTTACGCCGGTAAGGTGTATGAGCAAACGCTTGGTGAGGAGCG
CTACACGTTTGTGGAGGACGTCCAGCACCCGAAGTCATGCACGATTTTGATTAAGGGTCCGAACGAGCACACGATTGCACAGATCAAGGACGCCATCCGC
GATGGTGTTCGTGCTGTTAACAACGCCGTTGAGGACAAGGGTGTTGTTCCTGGTGCTGCTGCGTTTGAGCTAGCTGCCAACGAGGCTCTTAACAAGTTTA
AGGGCACGGTGAAGGGTCGTGCCAAGCTTGGTGTGCAGGCATTCGCGGACGCTCTGCTGGTGATCCCTAAGGTGCTGGCGGAGAACTCTGGTCTCGACGT
GCAGGACACTCTGATCGCTGTGCAGGAGGAGCACCAGAACTCGGGCATGCCTGTTGGTATCGACCTCTTCTCGGGCGAGCCCATGCTGCCGGAACAAGAA
GGTATTTGGGACAACTACCGGGTGAAGCGCCAGTTCATCCACCTCGCCACGACGTTGGCTTCGCAGCTGCTGCTTGTTGATGAAGTTATGCGTGCTGGCA
AGCAGATGGGAGGTGGCGGCATGCCCGAGCAGTAAGTAGGTAGGCGGATGCAGTAGTTTATTTCCCCCAGTCCATCTACTCCACTCCCTGAGTCATAATA
AACCAAGAAACCCCGATACATCTGCATATATTTCCTCAATTCGTGGCTTAGCGCACAAACAATAGATAGAACACCAGGATGTCAGTGATAGACAGCGCCA
CGATGACCATATAGAGACAAACTCTCTTTCGATACGAGCGGTCAGCAATGATCTGCAGGAGATGGCGCACTTGTCCTGTCATGCTCGAGGTCTCTGAGAC
CATTCCCTTCATGTCGTGTAGCTGCGAGCGTTGCAGTTCCAAGTCCACCATTACATTCTTGGCCACTTCCTCCGACTCGGCCACAGTGCGACGTGTGCGT
TCGATGTTGTCCGACGTGCGCATCAACGACCGCACGCTCTAATATTCACAATAACATGAATTATTATGGACATTGAAAAGATCACTTAGGCTGTTGACGC
ACGGGATCTGCCGCGAAGAAGGTGCTGTAGTTGTTCATATTGGCTGGGTCTGGTCCTCCACCCGTGACGCCGCTGGTATTATCGCTAGCGAAGATGCCTC
CGCCTCCGTTCGTCCCATAGCTGCCAGACATGACGAGAACCACCGCTGATTTATCGAATGAAATGCTTCATGCGGAAGAGACCGATAGAAGATACCGCCA
CCAAATTATGTAGTTCACACAAAATGTACATGATTCCATGTGGAATACATCGTTTTCAATATTTCATGTGGAACACATCAGTTTCATTTGCATTATGAGC
TTCGGGAAGACTAACTACCGCATCGGCGGCACGCGCGGTGGCGCTGATCGTACGTCGTTATAGAGCTATTTATTAAGATATTATTGCTGTTACTGTATTG
TACTAACTGTAGTTCAATTTTGTGCCGTGTTTTGTCGCTAGAGTTCAAGTGGGAGGACGTCAAGAACGACAAGTATAGGGAAAACTATCTGGGCCACTCG
GTACAAGCGCCTGTGGGTCGCTGGCAGAAGGGCAAAGACCTCGCATGGTATGCTAAAGCCAACAAGTCGCAGCGGGCAGAAGCGCTGCAAGCGGAACTGA
CGTTGGCTAAGCAGCGGGACGAAGATCTTATGAATGAAGCATTGTAGGTTGCTGAGTGGATTTATGGAGTTTTTGCAGAAGTTAACGAGGTACTTGCTGT
TGGCCTTTGTATGCAGAGGCATTGCACCTAAAAAACGCCATGAACCTGCTGAAGGTTTGAGTGCGTCAGAGATGAAGGAGCTGTTAAAACGAGGAGAGGC
GGAGCGAGATGGCATGGATGTGGAGCGTGTTGAAGGACTCGGGGCTGCGCCAGTGGAGTCTGCGGGCTTCGAAACGGGACCGAAGCGTACATTGGCAGAA
AGATACAAAGATCAACTGGCCAGTGGCAAAGCGGATATGACGTATGCACTACCAGGCACTATCAATGAGCAGATGATGGAGAAGGAGTCAAAGGCGGCAA
GGAAAGAGGCCCGCAAGGCTGAGAAGGCAGCGAAGAAATTAAGGAAGAAGGAGAAGAAAGAACGCAAGAAGGGGAAGAAGGCGAAACGCCATCATACACG
TGATTCAGACGAAGAAGATGCTGAAAAACTGCGTCATCCACATCACCGCCATGAAGAGGATGAAGACCAACGCAGTCGCTCTCGTTCTCCTCGGAGAAGC
CGAGATTCTGGCCGTCGTTCACGCTCTGTCAGCCGACACCGTAGTGAACGATCTCGATCTCCGACTGGTCGTCGTAGGTATGAGGCCTCTTCACCCAAAC
GATCTCAGCTATCTACGGACTCTCGCGGTCGCTCCCGGTTTCCTGGTAGCCCTTCAAGCCGATACCGTCACCATCGCCACCGTTCGGCTTCTCTATCACC
AGCCCCTAGAAGACGTTCCCGCTCTCGATCACACCGACGTTATTAACCAGGCTTACTGGAGATGTTCACAAAGGCCCTATGATTTGCATGCTAAATTCTT
TTCTGGTCTATTAGACGTTAGTGTGGTGAGCTTCCACATCACTGTCTTAATCGTCTAGCTTACTCAGACTTTGATGTCGTGTGTGCCTTCTTCTGTCGCC
CGCAGCGTTCAGAGCTACCATCCTTAAGCTCATAAGCGGGTAGGTAGTAGCCCTCCTTGCCGTCTTCGCCTTTCCGCCAGAGTTCTGGGTTCTGCACTGT
ATCGAAGATGTTACCTAGCGACGTGTACCCGTGGTCGTACAGCGAGCAGTATTCCAGCTGGCAATCACGTAGGAAACTCCACACATCTGCGTAAGTCCAC
TGCAAGATCGGGTTCACACGTAGGAAAGGTGGCCATCCAGGGCTGCTAGGGGAGAAGTGTTCCATGTCCTCCGTGTACGGATCGCCACCACGTACACCCA
TGTAAATGCCCTTGATCTTGAGCTTCTCCAAGATATCCTTGACTCCCTCCACAAACGAGCACTTGTACACGTGACAACTGAGTTCGTACTTCGTGGTGCA
TTCCTCTGTGAACTCTCGCACCTCCGGAAACTGGTCGTATGAGTCAAAATACATGACTGGCACACGCTGCAACTGATCCTTGACTCGAACTTCCAACTCC
TTTTCTTGCAGCAATTCAGCCGAGACAAAACTGTTTCGCGGCGATGTAACAGTCTTGGGGCCATCCTCAGCTTCCTGTTGAGCCTTAATGTGCTCTAGTT
GTGCCTCTTCCAGCACGCGCTTGGCCACCACAATACGGAGCAAATGTAGCACCACAGTCGAGTCTTTTCCCCCGTTAAAACTGAAGCAAACGCCCTCAAG
ACCGAAGATGTCGATGGCACTGCGCATCACGTCCAGAGCCTTCTGTAGTCGCTTCTGCATGGCCGGATCAGCCCCAGCGAAGAAGAGGTCGAAACG