Description :
From Genome Similarity Track
Location :
Scaffold_14:408243- 418860
Transcript NameFunction/comments
g1247.t1hypothetical protein
g1248.t1hypothetical protein

Sequence
10617 bases(100 bases per row)
TACAACCAACTGTGTGTGCTTCGTTCGTCGAACTCGATTCCACCAATCTCGTTCAAGATAACTATAACTCGACTTGGAAGTACTCATTTCCCGGTTTGGC
TGCTGATTTCCGTGATGTAGGTTGTGTAGTTCAATCGATCACGATGTACAACTCCGAGTATAACATCGGTTCATACAATTCTCAAATAATTCATTTAATG
TAGAAGTTCCTACTGCCGCAACAGCATTGACAATCCGTATAACACTCCCTGATGGAATTTATGCATACGCTGATATCAATTGGAGCATCCAGATGACTTT
TGTTAATGCTGGAGCGTATTTGATCAATCCATCTGTCTTCTATATCCAATTATCAGATAATAGCGCTTATTATGCTGCTCAGTTTGATTTACACCAACGT
CTCTACTTACTGCAGGTGGTACTTGAACAAGACCCGCTGCAGGATTGTATTCCTCTGGAGGTATTGTTTTGCCGACTACTACTCGCGTTCCTCGACTAAT
CAATTTATAACGCGTCTTTTGGGAAGGTAGTAGGACTGACTGCTGGTGCGTACCTTTCTACCTCTGCGACGGTTGCAAGTGCTCAGCTCTCGAATATCAT
TCCTCAGATCCACCCTACTAGCTTATACATCGTTCGCTGTGATCTGATCAACAATGAGTACGTTGCATCTAGCAATATTCTGAGTGGATCCGATCGAGGA
GATGCTAAGGTATGTAACGGGCCAGGTGAGTGCTCGTCACTAGCTTACACGTAGCGGTGAGGAAGCGTCCAATAAGCTCAGGTATACTGAGACCAAGTGT
TTAGTCTAGGGTAAAATCAACTCTGGTTTATTATTGGGACCGGGGCGGGTGGCCCTCGGATCCATGTGAACCACTCAAATGCAGGTTGACACCTGATTGG
TCGAAATGGGTCTGGCTCCCCACTTTCAACCAATCACAGGATGACAACGAGCGTGCCTTTGTACCTACTTGTAGATCTACCTATATAGATCTACCTACAT
ATGTAAATGGGAGGGGCCAATTACAAGGTAGGTCAGCATATTTAATACAAACCGAGTCAGTACGCTTGGATGAACAGTCGTACATGTAATGGCGTGCGTA
CCCCAGTCATGATCAGTATCTACAATTAGAATTACCAGAAAGTCAAGTTCCACGACACTTCCGTCTCAATCATGCTCCTGCTGAGACCAAAAAAGCTGAT
AGCTTTAGTTTTTTTCTTATAATCTAAAACTTCCTCCTGACTTACCCTCCTTTCGCACAGCTCGGAGCTTTGCCATATGAACATTTGCTTCTTATGACCC
CTTAGCGATTTTTCCCCCTTTCTAAGCTACTCATACTCCATAGCGTCGCTTTACTTCACCTCTAATAGATTTGATTAGATTATCATGCTCTGGTTTTGTT
GCCTTGTATTGAGGATATTGAGCATTACCGGTTTGGTATCGGTTGTTGACCGTGAACCGGTGAATCCGAACCGGTCCAATCCGAACCCACGCCGATTACG
CCACCAAAGGTTACGCCACTGTCGATTACGCCACCTGTGGGTACAAGATTGTAGGGAAAAGATGGGCTTCGACGTGGCACTCTCTGATTGGCTGAAGTAA
CTCAGTATCCAGTAAAGAATCAAGTAGTGTGTATCCAGTAGGTCTAGAGAAGCGAGAAGGCTAGCGAGCTAAAGACCTCAATCAATCACTTTCGAATCTT
TGTTCTATCCCTCAAGTGGTTTCCAGTCTCCGCTCCGGTCTCGCCCAGAGTGCTACCCTCCCTCCGCTCCGTCAAGCTTACGGTGTCCAAGATCCATACC
TTTCATCACCTTGCTCAGTAGGTACTTCTCTTCAGCATCAACCGCATCGGTTAGAACTCCTGTGCGCTTATCATATGATAGTGGATGCTTTGCTGTCTTC
TTGACACCTGCTATTGATAGACGACCTCCGTCCTTTTCCACATCGCTGTCAGAGTCGAACATACCAAATCCTGTCAATGACTTAATTGCTGCTCTGGGCG
GAATTCCCGCGTAAGGAGTTTCAATCACTGTCGCAAGAGCTGGTACTGCTGCATCAAGTCCTTTGCTGAGTGATCCACTATCCCTTACAAATTTGAACGC
GGAGGATAGACCAGATTTAATCTTACTCCAAATAGAGTCTCCTTGGCTCGCTTATAACCTTCTTAATATCATGCCTGGTAGTGTTAAGGCGCACGCCGCG
ACCTGCCTTGCGAGGTTTGACCGCCTTCACATAAGAGGCTGGATGAAGATGGATAACAGAGCCACTACCCTTGAGTTGATCAGCTGTCAGACTTAACTTA
TCAGTCTTGAGAGCTTTGGTCAACTTGGGAGTTGGTACGTCGCTTGAAATAGCTAGTTCGCGATACATTATTGCTATATAGCTTGAAAACTTTTATGAAC
GAATTGTCAAAATCAGATCTATTGAGGAGTTCATCTTATTGTTTTGCTTACAATATAACCGGTGCTGCTGGTGCTATGGTGGGAACGTGGAACTATATGT
TGAACATCAAGCTTGTAGATCCTCACCCGATTATTATGGAGCTTGACTTGATGGCTAACCCACAAATTCGTCTTCGTTTCAGTGTTAATCAGGGCACTTC
AGCTATCGATTTTGATATATCCAATAGAATGACGCTAACGAGTACTACACTTTCGAGAGGTAATATCTGTTCAGTAATGGTTGCTTCAGGCGCCAGATCA
AACCCTATGTATAGTGCAATTAATTAATGGTGTGGGTTCAATTGCAGTTTCTTGGGGGTGCCGATATCAATGTGCTTGAATCTACAATTGATGGTACATC
TCGAAGCCGGTAAAGAAGCTTCGCTACAATGACTGCTATGATCGATGGTTCTATCAGCACGCTGGTACTGGAAAGCAACCGACTCAACTAAATGCTGCTT
TTGATCTTCGATTATCGGCGAGACCTTTCGACTCGGCACCTTGGACGCTCCACCCCGGTAGTTCGATTCGAAACTTCAACGTGCGCATGGGTTCGCAACA
ATGCTTCGATATTGGCCATGACTGTGATTTCCACCACGTCACTAATGAGGTCTCTAAAATTGTAAAATTGCTTCGATTAACGGGGATCTGACCCCCGAGT
TGGTGAATGCTCTTCTTGACTACCAGACATAATCGCTAACTAACGCGTTCTTATCGCAGATGTTAGTCGTCTGGCCGAGAAGAATATTTCACAAGCAATT
CAGATTCAGGGCGTGAATGCTGGTTGCCAGGGTACAAACATGCTCGTATTGGTTATTAGCGAACAAGAGCTGACACTGGATCGCTTCACCGGGGAGGTAT
AGAGTACTCTACAGCTTAGTAGAGCTACTTTGATAGTCTTGTAAGCTAACACAAAAATATTTTTTTTTTATCTTAGTTCAATTCCTTGAGTACTTTTCAA
TCACGAATTCACTCTTACGAAGCCAATCGATATAGTTTGGATCCATACGACTGATATGTTTTAGTGTATTCCCTTTGTGTTTACCCCATCTCATCAAGTA
AGAGTTGTCATTATTGAGAAACTTCGTATGTTTTAATATCACCACTGATGTTCAAGCTGGGTTGGTTGAGCATCCATCGACAATACCCTGGGTCGGAAGC
ATATACCTCCTCAATGGACTTGTTCTTGTATTTTCCAAAATTGAGCTAGAACGACATGCTATCAGTTAGATGTATCTATCCTTCTATATACATACCCCCT
TTAACTTTTGAGAAAAAAATAAATACAGTGATTGGCGTCTTGGAGAGCCACATCGAGACACTTGCTTTGTATGAAGGACGGGCTAGCCTTACTTACTATT
CTGCTATTTTTTTTTTGCCAGAACTGCCGCTGCCGAAATCGACATCCCAGATTCTCGGCTGCCCCGCCTTTCCAGGGGCGGCTGGTGCAAGCATTTTCTC
GCTCGGCACGGCTACCGCGTCCGCCGAACCCATGGAGAGATTCATTCGGTGGATGTGCCAGCAGCAATAAAGGGCGCTGCTGAGCTTCGGGCGAAAAAGA
TCGCCAAGTACGACTTGAACGACGTATTCAATGTCGACGAGGCCGCCTACTTCTACAAGGTCGTATCGCGGGTGTCTGTCTGTCTGGGTGCCGCTCCCGC
CCTGAAGGTCAACAAGTCTCGCATGACCTTCCTTGTCGGGTCGAAGGCCACGGGATCGGAGAAGCTGTGGCAACTGGTGTTGGGCAAATCCAAAAAGCCA
CGCTGGCTGCCGGAGAAGCCGGACAGCATGGACTACGTCGGCACCAGCAAAGGCTGGATGACCACACCCGTGTTCAATGAGTGGCTGGTGGAGCTGAACA
AGAAGGTGAATGCCGTTGACAAAAAGATCCTGCTGCTTTACGATAATGCACCAGTGCACAAGGAGACTGAGGAGGCACTCTCGTACGTGGAGATCGCCAG
GCTGCCGAAGAACATCACGGCTATACTGCAACCTATGGACCAGGGCGTCATTGCGTGGATCAAGGCAAGGATTTTGAATGATAGATCAGGCGCTGCTTTA
CTGAGGGTTCTGTGTGTTCAGGAGGATGCATGTGCTATTGATACAGCAGACGCGATGTAATGGCTTGGAGACGCATGGGACACCATGCCCAAGAAGGTGC
TTGCGAACTGCTGTAGACATACAGGTCTGCTCTCAGATCGACTAATGAGTGTGGGCCAAATTGTCAATTAAATCAATACTGTGACGCCTTGCGCAAGGGC
GGTTGTCCTATCACAACGCGAGCCCCGTCTAAAATGATATTATCAGGTGGTCATCCAAGACGCCTATCACTGTAAATGTAAAAGTAATAAAAAACTGGCG
GCGTAATGTATATTGCTTTTATCCACATATAGTTTGATTGGTGGTGGTGGAGCGGTTCTGAAACTATCCCAAGATCCAAAGGATGTCTCCTCGAGGTTGG
TTGCCACAGCTCTTGGTTCTCAGTGCTCGAGCGTTTCTAAAACTTCCCTAGTATGCTCTCAGGTGGTCGAGAGGTTGCGTCGTCAAAATAGCAGCTGGCT
CGAGAGAATGTTCCAGGATTGTTCTCGGTGGTAAATTACGGAAAGTAAAATAAGAGCGTAATTTATTACTACTGTAATGGGTTGTGTATGTCTGGGGTGG
AGATGCTGTGTCTGGCTTCTAGACACCCGTGGAAACGGGTGTGACGACGGCGCCGCCTCTAGCAGCGGGAGTCGTGGGTTGTTCTACAGAGATGTCCACT
GCGTCTAGGTCCACGTTGCTTTTGCACATTGGGCAGGACTGGAATTCACACACATGCGAACGCAGGTAAGAGGAATAATAGCTTTGAAGTGGAATGTGCT
AGTTGGTGCAAACGTACCGTGTTGCGTCGCAGCCACTCATCAATGCAAGCCACGTGGAAAATGTGTTTGCACGGCAGGTTGCGGACGTCTTCACCGTCTT
CAAACTCGATCTACCAAAAATCAACCGCGAGCAAAATGTAAGATACCAAGAAGTTTTTAGTTTTGCAAAGTGGCATGAGCTTACCAAGCAAATGGGGCAG
ACGTCTTCATTTTCCGACGCACAACCGTCAGCCGGTTTGAGTTGCTCCGTGGGTGCTTCTGGGTTCCGCTCAGCACGGCAGTATTTCGTGATCCTGAGCT
GCTCCAATCGCTCCTTCGTGACGCCGTGAACAACTGCAGCGCCGCGCATCTGGGCAGCTCTCAACTACAAACGGAGTAAGAAACGATTAGTGCGTGCGCT
GTCAGGTAGGTACCGAACACTTTAGTATTCAGCACTACACAACTCACATTTCTTCGATCTGCGCGTCGCCAGCGGAGAAGAAGCACAAGTAGCACGAAGA
CGACAGTGACGATGAAGGCACCTAGCACGTAAACCAGCGATTCAGGATCAAGAGGGAGCGAGTTGGTAGCAGCATCCGTCGTTACGGCGTTTGTCGTGTT
GTACACCCATACATCACCAAGTTGGCTTTGGTAGCTGCCACCATGGATTATCATGCTATCTCCGCGCCAAAGAGCAGCGCGATGATTGTAACGCAGCGGT
GGAGATGCACCATCGCCTTCGATTTCGGCTTGCCGTGCTTCCATTGCCATGTTGTTCAAGTCAAATTTCCCAAGCACGATGTCATCGTACACGTAGCCGC
TAGAGCTCTGCTGTGGTTTATAGTATCCTCCGAAGAACCACATATTTGTTCCTTCAGTGGTGACAATCGACGTGTAGGCACGCGGGACTTCGGTCGTCGG
AGTGACGCTCGTCCATTTATTCTGACTGAAGTCGTAGACCCAGACATCATTCAGCAGAGTCCAGCTCGAGAAAAGGAGATGGCGGCCGCTGTACGCGAGC
AGATAGCCTTCGCCTTGTTCGTTGCTGTCATGAAGCATAGCAACCGAGTGTGAAAAGCGAGTTGGGGGCTGCAGATTTCCTGCGGGCTCAATTTTATTCC
ACGTGTACGTGCCAAGATCATATCTCCACAGGTCGTTGTAATCGGTTGGAGCCTCGTTGCCCTTCTCGTCGTACGCAATGCCGCCGAACATGAAGAGAGC
GTCGTTATGAATCACGATACCAGCCTCCGATCGTGCATCCGGTACAACTTCCGAGTTGGGCGGGGCAGGATCCATTCGCCATGAAGGTGTTTTCGCTGTT
AATGAAAGCCGCCAAACATCGTTGTACTGCACCACTGGCACACTGTTCGTCGCTGAAGCCGTGATCGCATCAGTCTCCGCAGCCAATATTGATAGACCTC
CGAAAACTATAAACTCGCTGACAGTGAGGTTCGTATGGAGCACTCCAGCATGGTGAAATCGGTTCTGAGGTCTCTTGTTCCCAACTGGTAGTTCAGTCCA
CTGCCGTCCAACGAGATCGAACTTCCATGTGTCGTTATATTCGACGTCTTCGTCGATTGAGTTCGTGCTGATGCCTCCGAATACGTACAAGTTATCCTCG
AAGGTGGCGATAGCATGAGCTGAGCGCCGCATAGGTTGCACTGAAGCCGGACCGAAAGACGGGTCCCAAAGCTGTGTCCACTGTGCCGGAGCAGCAGCAC
CCATCATTTCCGACATCATCTCCATTACAGCGCAAGAAGTCCCTCCACAGCTGATGTGGATGTCAACGAGCGCTTGGAATACACAATGCAGGTGGGCCGT
TGCGAACCAAAACGGTAGCATTACGTTTGTCGATCAGACTGCGAGGTAGGTATCGTAGCATGGACCCTAAAATTAGGGAGCAGGACATTCACAATGATTA
TATTGCATCTGATCCATGCTCTCCGGCCTGAACGAAAAGAAGTTGAGTTCTATTGTATATTGAGATAGAAAATCCCGTTGAAGTAACCAAGGACCATTTG
TACATCTTTGGTGGTATTAGGGGGTCGAAGCAGGCAAGTACATGGTGCGCGGCGATACAAATTGTACAATACCCTTTTCACCTAAAATCTTCACACACCT
TAGTCGTTTGAATTCCAGAAAAAAGTTTTGAGAGTTTTAGGTGAGTTTGGAAATTGGCATCGATGAGGAAGACTCAAGCGAATAGTACACGGACTCAGGA
TGCGGCGGAAAGAGCCAAAACAATTATTGGCATTGGTGCTTCGACCACACACAATCGTGGTTTTGTTTTGCAAACGTGCAAAAGCTTACATGTACTTCAA
AGTATCACGTAGCCTTGTAGTGTGATCAAATCGTAACACTGGCTGCAGTTAACGTTGGTATTACTGCAAATGATGTAGATGGCAACCATGAAAGTTTCTA
AACCCTTGAACCATACATAACGATGCTCTATGTGGGCAAATTTAGGGACGATGGTTCAGACGTCTTGGATACCCCATCATCTCTCGTTTCCACTGGGTGA
TAATTGCTGTCATCCTTATTGTAGCTGTTCGCTTCAAATGAGTGGTCTGAAGTCGTGGCAGCAGACTCTTGCCGATCTGTTTGTTTGGTGTCACAACTCA
CTTGCCTAATAAACTGTTATGACCAGACGACGTGGTAATTCTGTCAGTCATCCAGTCAGCTGCAAATCCGAGAAGGTAAAGGCTAGTTAGTACCTGTTGA
ATTTGATCGCGTGCTTGCAACTCAGCTTCGGTCAGTACAGGGAATACCCAGTCACCAAGTTCGTGGCGCTGCTCAAGAAACCGGATCATCGTTTCCTTCG
GCAAGCTACTTCGTGAAATCAGGGCTGTCCACTAAAATAAAGTTTTCGTCAGCATGTCTTGCAATTTGCGAGTCGCAAACGCGCCCGTGTCTAAAGTCAT
GGGGAATGCTTACATTTAGCTGAACATCCACCAGCTTTTTGATTTCTAAGCCGCCAATTACCGAGTGTATCCGCCACAGTTCCTTATCGCGCTAAGTTGA
TGGAGATACGGGTACAGTTAGCATCTGGGAGCTTATTCACTGCTATCATTTGAAGTACGTACCTCATCCACGCCAAAATCTCCTAATACATCTCCCTTGG
GGTCCACAGAGTCGAGAATGGATACAACGTGGTATTCAAGCTCCGAAATCGTGTCCACTCCCGCATACTGTTCAAAACTGTTCGCTTGAATTTTCTTCTC
CAGTGAATCTAAGACGATGGTGGCTGGACCTGATCGGATGGCAAGTTGAAGTAGAAGTCGCAAGCAGATGAACCGAATGTCGTTCATCGCTAATAACACC
ACATAAAGCGTCAGTTAGAGCTTAGACAAAAGATTTCGTACGCTAGGCGATTTGACACAGCTATGGCACCTTTGCGTTTACTTTTAGCAGTCTGACTGGC
GCCCCGGGATGAAAACATTTGATCGAGCTGCCGAAGTCCCTTGTATACGCCACACACTAGATAGATAATATCGATTTTCCACTGTGCCTCTCGCGATCTA
GAGGTTATCAGATTTTCGTACGCCTCCGCAACACATGCCAAAACGTCCAGCAGCATTCGAACGGTAAGCTCGTACACCTTTTCGTGCACCCCAAGATTTC
GTTCGTACTCTACCAGTACGGTATTGTTCACATACTCCAGCAGTAGCTGCATCCGGAAAACGAATCCCTGTACCGCGTACGTGCACCGAGTATTGCCAAA
CCAAGGTTTGCTTGCTGTCCACGACTGCTCATATATTCCTGGGAGCAAGTGGTTCATACATTCATGAAAGAAGGCGCGATGTGCGTAGTGAACAAGCGAG
TTCATCATCCCTAAAATTTGCGCTTCCACTTGCTCAAAAGCTTGATCGACCCAATTGAGATGAATGCAGCGACTGTCGTTGTCGACGTTGCGCCGCCTGC
TCTTTCTCCCTTGTCTTGCCAAAGTATCAACTTGATGCCGGCATATCCTCCACACGAAGAGCAGCCTGCATGAATTTGCGTGCTCTGATACAACGTGCTC
AACGGTGCATGACGACAACTGTAGCATAGTAAGCATATGTCGCTTCATCTTGGCGATTTTCTCTAGCAGCACCTGTACAAATGCACAGCTCAGCGCAACA
TTTTGAGCCTGGATACAGGTGCCGACTATCTCCGTTTCTTCAAGTAAATGGTGTGCCAGCTTCTCAAATTGTGATAAAACTCTACATGTAGTAGATAGCG
AAGTCTCAAAACTCGTGGATCGAGTGGCTGAGCCGATCTGCCCTACTTGGGATGGTCGCCGAGAGCAGTAGGCACCGCCATCGCCAAAGTACCCAACTCC
AGCTTGTGAAGTCACTCGAGCAAAGTTACCTCGAGCCGAATTTACGACAGGTAGCGCAGCTTGAGAAGCGCCCATGTCCCTCACAACAGATTGCGGTGCG
TTCTCTTGACCAGGATAAAATGCGTTTCCAAGGGAACTCGACCGTACCATTGAAATGGAGCGCGACGGAGTTGTGTGAGTGGTGGGAGTCAATACATCGT
GCTGCAGAATAGACCGAAAGTAGCGTGCGAAAATGTGCTCGCCTTTGCTGATCGAAGATTCCACGGATTTCCATAGTGCATTACCCACCTTGTCGTTTAG
CTCACCATTTGGAAACACGGAGCTAATTTCAACAACCACAGCGTGCAAGGCATCTAGAACTTCGCGAAACTTGAGACCCATGTGCACGCGAAAGTTCGGG
TTCACCGGGGCCCCGATGAAGCGAAGCTCGCGCATGTTCACCCACTCATTCAGTGACAGGAACTGGGTCCAGCTCACCACTTCGCTACATTTTTGAAGCG
ATTTTTTAATTTGAAGTTTGCACCGCTTGTCATCCACGTTGATAACGACAACCTCGACCCACGCACTATCCTTGCCGTTGTTTACTAAGACACGCTGGCC
AACCCATTTAGATAGACCTCCACTTCGACCGAATAAACGAGATCCATCTTGCTCACCTCCTTTTCCGAGAAGCGGTACGTACAATTGACCGTCTAGCGTC
TCGACTCGTCCAAAGATTTCTCGACTCTCATCGTCATGAACCGTAGTTACGTCCCTCTCCGAAATGGAACACACTGTTTTCTGCCACCATACACCCACAT
GATGTGGATCAGCCACGAGAAGCTTAGGCTGCTGGCCTGAATGAACTGTTGGTAAATGCACGAACCGATTCACCAGATTCATGAGCATGTCCGGAAAAAT
TCCTCCTTTACTACGAAATTTGCGTGGGCGATAGAAGCATTGCACCACGAGTTGGGGACCAGTGTCTCCCACGTGCTTCGAAGTCGACGAGGTTACCGCA
ATATCGTGCGCCCATTG