Description :
From Genome Similarity Track
Location :
scaffold_8:40821- 45711
Transcript NameFunction/comments
g512.t1 integrator complex subunit, putative
g513.t1hypothetical protein

Sequence
4890 bases(100 bases per row)
AACACAAACGGCCCTGGCTGATTCAGCTTCTTCCAATCGAACGCTTGGAGGTCCGCAGCATTTGGGTTCTTTTCACGCAACAAACTCTGAACAGCAGGCG
TGCACGTTCGCGACAAGAGAGGCAGGAATCTACTCGGGTATTCCATTCCATCCGATAGGTAAATTGGACACTTCGCATCCTTCCCAGCGGCGTCCTTCAG
CTGTTGCCAATGACCGAGCAAAATTGTGATCAGTTCGTGGAAGTACCCCAACCGGTACACCGGTATCACCACTTTGCCGTTGGAGCTGATGCATTCCAGA
ATGACCTTCACCAGCTCTCTCTCCATCGCACTCTGCGTCTCCGATACCGTCACAGCAAATGAGCTCCGAGTAATCAACGCACTAGGCTCCAGTCTTGGAA
TCTGTGCCGGTAGCAGCACTCGTCCACCCGTGAGGTTAAAGTCATTGGCGAATAGTACCGTTGTGGATCCGATTTCCAAGTAGAAGGCACAACCACCCGC
CACATCCCCCGCATGATAAGCAGTGACCTTCAGGTGCTCATTAACAGTCACACAAGCCTTCAACGCGAGCGCCTTCACCTTCCTGAAGCTTGGAGCGATG
TCCTGAACGTCGTACAAAGCTGGCAAGCCACTCCCTCCGTCCTTCACCTTCCCATGGCATCCAGTCCTGCAGTATCAAACACACACCTTCAGCCTTCAAA
TACATCAGCTATATAACCTAGGATCCCGCTGCGTTCTTACCAATATTCTGTTAGGAGATGGGGTGCAATAGCTCGCGTCCCGTGTGTCATAAGGATAGCC
GGGGGCTGTTTCTGGCTCGGGTCTTGCGCTGTGCCGGCGGATGGAGCAACCCACGACACACCGCACTTCTCAGTTACGTAGGGCAACATGTAGCAGGATC
CAGGACGATAGTTCGGCACCAGGATGGCGTCAAGAGTGCCGCCATCGCGTCGCAGGAGGTCCTTGAGTTCGCGTCGGTATTGCGTCGTGAGTGCCTCAAA
GTCCTCGGTGTCAGCATCGTCCGGGGAATAGAAGGACACATCTTTCACCTCACCGCAGCCTAACAGCACACTGATGCCCGTAAGCTCGTCACGCAGGCAG
TAGGAAGAACCGTTGCCAAGCCGCTCTACAGATAAACTCATCTTTTTCAAATGAAAAAGAAAAAATGCTTTTTATAAGTAAATGAGCACTGAAAACACTT
TTTTTAAATAAAAAACGATCAACTAAGATATGCAATACGGTACAGCTTTGACGTTTCATTATAAAGTTTAAGATGCAAAATATGGTTGAAGATAAGTAAA
TGTGAACAGGATCTAGTGGCCGTAGACGTTAACACCTTCCAGCACACTAAATGGACAAATGTTTGTCGTCTATTAGCTGTCGTCTACAGCCAGAATTTGT
CTGCTTAAACAAGCTTACCGAAGAATGCTGGTAGCTCATCGGGAGTCAAGAAAGTCTTCTCCATTGTAGCTCGCGTCTGTACCTCCACGAGTCCTTCCTT
CGTGAACCGCTTGCCCACAACGACGCGGTACGGGTATCCGATGAGCTCCGACTCGGCCAGTTTCGAGCCAGGACTTTCTCGCCAGCGATCATCCAGCAGC
ACATCGTCCTTCACTAGGCCGGCAACGTTACCAGAGGAAAGTTTGCCAGCAATATCCCATGCAGCTTGAGACACGGGGTCTTCTCGCTTCTTGCCGCCGA
TGGACATGACAAGAACCTTGTACGGCGCAATTTCAGTCGGCCACGCAATGCCATGGTCGTCGTGTGATGCCTCGACTGCGGCTGCAACCAGTCGACTAAC
ACCAAGACCGAAGCAGCCCATCTCTAGCGGGTGCTTGTTGTTCTTCGCATCCGTATACGTCGCGCCGAAAGGCTTCGAGTACTTCTGTCCCAGATAGAAA
ACGTGGCCCACCTCAATACCGCGCTTGTCCTCGAGCACTGCGTTCTCACCGTTGCAGCGTGGGCAGCAGTCACCAGCTTGTGCCAAGCGGAAGTGTCCCC
ACACAAGGTGAATGTCCTCATGCTGTCTTGATATCGTTTCTGCAAAGTTACATAGAGCTTCCACAGCTGGAGAGGCTTGATCGCCATATTTTAGCGAATC
ATCCAGAAGCAAATGCAGCTCAGTCTTCGGATTAGCTTTGCCGAGCAGGTCGGCGATCTTCGCCTGATTCGTGATCACCTCGCCTTCATCGCCGCCAATA
AACGGCTTAGCAGCTAATTCATTCGCCTCGCGGTCATGCCGAGTAAAACACAACGCAACACGCGGCTGCACTCTGGTCTCGAGTTCATCAATTTTAAGAT
CCGCCAGATCATGATCTTCCTCCTGCTCATGCACATACTTAACGGAGAAACCGTGCGACCCCGCAACTTCCTGAAGCTCCATAACAGTCGTCCACATCTG
AGAATCACCAGTAAGAGCTTGTCTTTCGAGTCGCGCAATGATGGCACTAAGCTCTGTCGAAACTTCGGCAATGTGTTCCATCGGCGTCTGAGGTAGACGA
CCCTCTGCCTTCTCCACATTAGCCGCGTAGTCGCAATCCTTCGACGAGCAGGACAGAATCGCGTCTTCACCGATATCCGCCAGCACGTGGAACTCGTGCG
ACAGATTGCCGCCAATGTTCCCCGAATCGGCTTCCACTCGTTTCACCGGCAGTTTGAGTCTCGAGATCAGAATCTCATTGTACGCAGCAGTCACGTCCTG
GTACGTCTGCAACGCACCGTCGTACGACGCATCGAACGAGTACATGTCCTTCATCACGAACTCTCTCGCTCTCAAGAGACCAAACCGAGGACGGATCTCG
TCACGGAACTTGCGGCCGATCTGGTACAGTCTCAGAGACGAATTCGTCGCCCCCGCTGCATTGTAGTGAGCTGCCACGAGGCTTGTAATATTCTCCTCGT
GTGTGGGGCCTAGCACAAGTACATCTTCACGTCGGTCCTCAAGTGTCATAAGCTCAGGCCCGCGAGTCTGCCAACGACCCGACTGCTTCCACAGCTCGTT
GGGCGTCAGTACCGACAGGTCCACGCGGTTACCGCCGATCTTGTACATTTCGTCGTCAATTATCGCCTCCAGTTTGGCCACAACGCGGCGGCCCAGCGGC
AACAGAGCGAAAAGGCCATGACCACCTTTGCGCACGAAACCAGCGCGTACCAGGAGCTGATGGCTGGGAACTGCCGCGTCTGAAGGCGCCTGCTTCTCCG
TGGGGGGCCACAGAACGGACCGCAAGGCGCAGGGAGCAGCGCGGATCGACTGCGACGTCGATAGGCACCGCCCTGCAGCTGCCAAGGAACTGCGACGCGT
GCGAACCGCCCACATCTATCTGGTTGACAAGCAATTTGAGCCGCAAGTACTGTATCCGGGAGATGTGGTGCACACGACATTATAGTTGGCAGGTTTTTGA
CAGGGGTAACTACCAAAAGTGTCGTTGCACTTTGGTCGGTAGCTGCACACATACTGTAATTGATTGAGCATGCGATACTTTGTTTTCTACACTAGATACA
AGTGGAAGGCCTGGTGAAGACAAGTCGGAGGTGGGGATTTGCTCGTAGTGCTGTGTTGAAGGTCAACTTGACTGGGTTTTCAGCTCAAGCTTTTTCGCCG
CGGTGGCGGCAGCACAGCGAACCACCTTCTCTTTAGCAAACTAACAAACTCACTGCTCGTGGAGAAGACCAGGGCAGAGAGCCCAACAGCAACCCGCGCC
ACAATACTAATACCGACGAATTTTAGGTTGGGCCTGCCGCTCCAAATGTTTGGAAGTGGCACTGCTGAGCCTGCAAAGTGGACGCAGGGCTGACTCATCG
ATGATCATGCTGGCGCCAACGCCAGCTGGGCGGCAATTGCCGCACAACTTGTTGAGCATGGCGAGCTTCCTCTACGCGGCCTCAAGGACGCTTTTGCAAG
GTTTTCACTGCGCGCGTCGCCCACTCGTGTTCCGGCCTGCATCGTAGCAACGTTCATTAGCAATGCGCAGGCAACGTAGCGTCGAGTCCCTCGTCAAGCA
CGGCGTCGACACGACAATGCGGCTTCTTTAGGCCAACGGGTACACTTAACCCACGGGGCTCGCTTTAGTGCTTAGATGTCCATCCTTGATCCAATATTCG
CACGCATGTTGGAAGCGAAGCGAAGCGAATGCAGCCAACAGTCCAACGCAGGAAACTAGTGTAAGGTGGATTTTCTACCCATGTGCACGTTCCATAAATT
AATGTGCATGCATTGCCATACAATCACTCATCAGCCCCTGTTTCCGTCCCATATTTACCTGTGCACTGTTCGTCAAAATTGAAGTTTTAAACCAGCTGCT
TTTAGCGGAATTATTTTTTTAGGCTAGGTGACGAGTCGCTTTTAGGTCAAACAGTCAATTTTTTTCCGCATCAAGACAGAAGACCCGATGGCTTCGCGCT
GGCGCCATAAGAGCAAAAGCTCCTTCCAGGATCCGTCATCACCACCGGCGCTTCTGGACGAGGCGGCTCCCAAAGTCAGCAAGCGCTCGCACTTCTCGCG
CCGCAGTACACGCGCCAAGAGCCTCGCGCAACAGCAGGCGCAGCACGTGGAGTTGGAAGTGGAAGAAGCAGCGGAAGAGATAGACCGGGACAAGCGCCGC
AGCCTTCTAGCCTCCATGTTCGGAGACCGACCACTGTTGCGGACGTTGCGCTCGTCTTCTGACGCCTCGGAGACGCCGCAGACGCTCGTGCAGAGAGAAA
AAGGCTTTCGACTGGTGCGTCACGGCTCCGATCCGCTCTTAAACGACAATTTCTACGCAACTCAGGTGCAGGTAGGCAACTTTGTCAAGATGGGGTGGCT
CACGAAGCAGGGCCACATGTGGAAGAGCTGGAAGACGCGCTTCTTCGTGCTGTTTTCCGACGGCACGTTCGCCTACTACAAGAACAAAGG