Description :
From Genome Similarity Track
Location :
Scaffold_93:40820- 43202
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18852hypothetical protein

Sequence
2382 bases(100 bases per row)
GTTTAGGACAACGATACAGTGGACGCTAAGCCGGTAGCACAACGCGTATGCAGGGTGGCACCGCAGTTCCGTGGCATACTGTTCGACTTGATCAAGGGCC
TGTTGTCCGCTAAGATCATTAGGATGTCTAGCTCTCTGTGGGCGTCGCCGATTGTGGTGGTAATCAAGAAGAATGGCGTCGACATCTGACTCTACATTGA
TTACCGCGTCGTAAACAGCTTGACGAGCCTCATGGTGTACCCCATGCCGCTGATCAACGATCGGCTCGAAGACTTGACAAGGTGCTCTGGTACTGTTCGC
TGGATATGGCGAGCGGATTCTGGCTCGTGAAAATGGCTGAGAGAGCCCGCCTGGTGTCGGCCTTCACCACACCATTCGGCCTGTTCGAATGGCTGCGCAT
GCCCTTTGGGCTGAAGAACGCACCACAAATTTATCAGCGACTCTTGGACAATGCGCTGTACGAGCGATCAATCCGGCGCGGCGGACGTATTCCAGGTTGG
TGAACCGGACACGGACTCTGGATCGCCGGCGCTTGATTGTCGATCGTACATCGACGACATCTTGGTGACTGCTGAGCCCTGGGACTCTCTCTCCGACAAG
GTATGGACGCGTGTGACCGGTGGAACTTGTAGATCAGCGTGGTGAAAAGCTTTTGGAGATGCCACAAGGTAGACTACCTAATACATCGCGTATCGGCGGA
TGGCCTCGAAACTCACCTGAAGAACTTGGAGACACTGACGACTCTGCCTTTCCCAGGAACGTTGCTATCGATACAGTCCTTCCTCGGAAGCCTCAACTAC
GACAGTAGGTGTATCGAGGACTTCGCGATATACGACTCGATCCTGTACGAGCTGCGAGAAGTCGACTTCCACGAGAATCGGAACCCAGGTCAAAAGACTG
GGGACGAAGTCCAGTCCAATGAGAAGGAGCAAATCTCGCAGACGGGCGAAATGAACAAGTGGGATCGGGCGCAGGCGACGTTTGAGATGTTGAAGAACAA
GATCGCGACGGTGCCCGTGCTGCGCCATTTTGATCCAGATCGGATGTCTGTTGTCGTGGTATATGGTATCGATTGGGCGATCTCCGCAGCCTTAGTGCAA
GAGCAATATGCCGGTAGCATTCACCAGTCGTACGCTGAAGCCCAACGAACTCAACTATGGTATGGTCGAAAAAGAGATCCTGGCTCTTCTCCGGATCCTG
GACGCGTGCTACTCCACGCTGGGCACGAGGCCAAACAAGTTTTTAACGCGGCACTCCACTCTAGCGTGGCTGATGCGATCTTTGGGACTCCAAGGCAGAC
TAGGCAACTGGGCGGCGCTGCTATCCCCCTGAACACTCGAGATTGCCAAGTGTACACGCGACGAAGATGAGATCCTGGGTACGAATCCGGCGAGCATCAC
GCCCCGGGAAAGTGTCGACTCGATCTTGTCGTCTATCGCGCCGAGGAAGCAGCCACGCCAGCTGATTCCAGCGGTGCTACCTACGGTTGAACAAGGCGAA
GAACTGTTAGTCGCGAGTTTCGATGGATCGGCACGAGTCAAACGAGGCGGTGGAGCGTGTAGCGCTATTGTCTGGAAGTTACCTGAATGAATCGTCGTCG
CAGCAGACTCGAAGTACTTGCCCGACCTAACGGTGAATGAGGCGGAGTACCAGGGCCTGTTGTTAGCCTTGATCTACTCTCCAGCTTGGCCCGGGGACGC
CTGATCATCTGCGGGGACTCCAACTTGGTAATACGGCAGATGCGAGGTGAGATCGAGTGCAAGGCACCAGGCCTGACTCCTCTTCGTCAACGGGCATTAG
ATCGGCTGAGAATGCGGCCAGCTCACGAGTTCCTGCATGTCAAACGAGATTGGAATCAGAGCGCGGATCGGTTGGCCAGCACAGCATTGAATCAGCAAGA
AGGCGCAGTAGTTACATCGGAAGCGGATCGCGACGATCTGGCTGTCCTTAACCGGTTTCAGGAACTTCTGCTCCCGAAGGACGATGGGCCTGTCGCCCGG
ATTGCCGCGGTGACCCGATCGCGAGCACGCTTGGAGAGCTCGCCAAAAGTGCTGCAGTTGATTGTGGTACAACGCATCAGGACGGACGGGATTCTACGAG
CACAGAACGAGGAGAAGTGGATCATAGACCTCAAGGCGTACCTGCCAGGCAACTTGGAGAGGCTAGATGCTAGTGAGGCGCGAGCTTGCGGCAAAATCAC
GCGCGACTACGATGTTGACGAAGGTGGGCTGCTGCTTTACTGTCATCGCGCAGGAAGAGACGACGGTGACCGCGACCGGCTGGCGAAGCTGGTGGTACCG
GAAGACCTGCAGCAAGATGTACTCCACCATTATCATACGAGTCTGGAGGAATGACATCAGGGGTCGGAAGAACGTACCAGCG