Description :
From Genome Similarity Track
Location :
Scaffold_601:4082- 6097
Sequence
2015 bases(100 bases per row)
GGTAGACGGTTACTACCAAGTCCTCATGGAACCGTTCGATGTTTCGAACACGGCCGTCAGTACGCCCAGCGAGATGCTTTGGGAGTGGCTGGTTATGCCC
TAGGGTCTCTCCAATGCATCCGCGACGTTCCACCGTCTCGTGACGCATCTCTTNNNNNNNNNNCACAGTCAAACTCCCAAAATCCATCCTGGGACCCAAG
TCCTCACTCTTACAGGGTTTTGAGCTCCAAGTGCGCGACCCCGCACAGGCGCGCGTCTCAGACGCAAAGGGAAACTGAGCGAGGCGATGAAGTCCACNNN
NNNNNNNTGTCATCGAGTGTCTCGAGAAGCGTCAACTCTATGCGAAGCTCGACAAGTGCATCTTCGGTGCTGACGAGATCCCGGTGCTCAAGTGTTTCGT
CGGGGTCGACGGGGTGCGGGCTGACCCCGNNNNNNNNNNTCGTTCATTGCGAGCCTTCGCCCAGACGTATTTCGACGATATTTACGCCCATACGAAACCC
GAGGCTGGGCGATATCTCGACGATCTCCACGAGGAGCATCTCCGGCAGGTCATTGAGTGTCTTGAGAAGCATCAACTCTATGCGAAGCTCGACCAGTGCA
TCTTCGGTGCTGACGAAATCCCGGTGCTCGGGTGTTTCGTTGGGGTTGACGGGGTGCGGGCTGACCCCGNNNNNNNNNNCCACGAAGGACTACGCGTAGC
TCGCGCGTCCGTTACACGGTTGCTCAAAAGCGACGTTGAGTGGTCATGGGATGGCCAAGCAGAATCCGCTTTCCGAAAAATCAAGGAGAGCCTTCTCTNN
NNNNNNNNAGAAGGTCATGGCCATCGCGGAGTGGCCGCCCCCACAGTCGATAAAGGACCTGCGGAAATGGCTGGGAGTTGCCAACTACTTGCACAAGTAC
ACGAAGGACTTCACGGAGCTCGCGCGTCCGTTGACACGGTTGCTCAAGAGCGACGTTGAGTGGTCATGGCCAAGCAGAATTCGCTTTCCTCAAAATCAAG
GAGAGCCTTCTCTCGGCGCCGATCCTGGCACTTCCAGACGACACCAGGCCATACAGTGTCGTCTGCGATGCGTCTGATTACGCGATCGGATGTGCATTGT
TGCAAGTCAACGAACGCGGTCGCGAGAGAGTTGTCTCTTATCAGTCCNNNNNNNNNNTGCCGCTGCTCGGCCATTATCGCCGCGTTGTCGTCTCCGACCA
GTCCAGCGTCTTTGGCTCCCAGGCTCCAGGCTCGGTTCCATCGATATCACCTTTGTGATGGGCTCCCGAAGTATCAGGTCCAGACAGTGATCCCGAGCGT
GTCGTTGTCCCGCAGGACGAGGACTTGCGATATGTTCTCCCATACGGTGTCCATGACCCTCTTGGTGTGGGGCATCTCCGCCGTGAGAAGACGTATGCGC
TTCTCANNNNNNNNNNGCATGCGTCACTGCGCACAGCGATCCAGTCGCCGCACCTTGTGGTTCAAGATGTACAAGTGGGTCTCTNNNNNNNNNNGATCCA
GTCGCCGCACCTATCACCACGGATGGCGTGGTTGGTTTCTTTCATCTCAGAGTACAATTTTAAGCTCAAGTACAAGCCGGGTTGGCTGAACGTCCTCGCC
GACGCTCTCTCTCGGCGACCCGACTATGAGATCAACCATCNNNNNNNNNNCGATATGTTCGCTCGTGCAAGATTTGCCAACGTGTCAAGCCGGGCTTACA
CTCGCAGGCACCCCTGCAAAGCCTGTTGGTCCCCAGTGACTGCTGGAAATCGATCAGTCTCGACTTTTTCTTCAATCTGCCACCGACGGTGGCGGGGCAC
AATGGTGTGCTCGCGCATCGTTATCGATACTGTCTTCCGTCTTCACGGATTTCCGGACTCTATCGTCTCCGATCGTGATCCGCGCTTCACCACTGACTTC
TGGGGTGCGCTTTTCGAAATTCTCGGAACTTCACTCGACACGTCGACAGTAGTTGGCTGCGGACNNNNNNNNNNCGTTGATCGACTCTCCAAGATGGTTC
ATCTTGTAGCCGTAC