Description :
From Genome Similarity Track
Location :
Scaffold_199:4082- 5709
Sequence
1627 bases(100 bases per row)
TTGTGTGAGCTACATGAAATATTATGACTGGCTAATAACCAACCCTTTTTTAGTATGGTATGTTTGGTAACTCAATACGACAGACAAGCTATTTTGAGGT
ATTAACAGTTAGCGCTCGTCAGCGGGAACGAGGGTGACAACAATTTTCAGCTGCCGCATGTTTAGAAGATCATTTTTCACGTGGAGCGCATCCCTCGTCG
TTATTGATCGCGTATGTGCTTGTCTCTGAAGGGTTATGTTTCTTGGAAATAATGACTAAGGCCCCGACTAGGGGCACACCCCACTTTTGCTACGGGCACA
CCCACCCAGCTAAGATATTAAAAACGACTAAGAACACTGCATTGCAAAAACAGACCAGCTGAACATATGGGTGATATGGAGAGAGTACAATGCGTACGTC
GATAGGTAATAAAGCTTCGTCTATAAATGCTTCATGCCCTCGCTGATAACGACACGTTGCTGCACAATCCGCCACCGGCAACACTCCACAAGAAAGCCAT
TCTTCTGACCCCTGCGGAGCAGTGAAATTGCAAATGCCTCGCCAAGTTATTCGCTGGTCCAGATGTTCCCGAACCAGTTGCAGTGCTGATCGTGGATTGC
GCCATGGTACCTATATCGTACATAAAAACGAAACGGACCTACTTTGCACAGTACAATCATAGAATCACGGATACTGATGACACAATAATGACAGCATGCT
CAGTAATCGGACTTCTGTTTCGTACGATGTACCGGATCAAATTGGATCGTTGCTGTCAAGTTGGTAGAACCAGTGTTACCGTCGCTGAGGTTATGAATAT
TCATGTTGGTCCCAATCCGACCGCAATTGTAGTAGACCTGTTGCAGACCCCGTCTCGTCTTCTTTGATCTGGCGACGACGATAATATACCCTTGGGTAGC
CGCAAAACCGTTTAAGGCTGTTTTCATCTCGTTCCTGGAAGGAAAGATGGTTCCAACGAGTGCGGAAGGTGGGTGTTGGAGCTGTTTTAGCGATGGTTGC
CTCTCTCTCTAGCCCTCGTCCGCCATTTCGGGAGTCCGGAGCTGGTGCGTTTTTTTATCCGGTGTTTTCTGTCGTATTATATGGGTGTGAGGGGACTCAG
ACACCATTGCGCGGCCAAGACAGATTCCGGAACAATGTTCTTTTTCTTTTGCAGGAGAAGGAATTCCCCTCCTTAAGCTCCACAACCCTTGGTTAAACGA
CTCGAGCAATCCGGTTGGGGGCATCTACATACAACTATACTGTACTGTAAACGTAATGTATTCTGCATTATTATCTGTCATTGTTTTTATTTTAGCCGGG
TGGGTGTGCCCCTAGTCGGGGCCAATGACTAATATGAGCCTTGAGCAAAAATAAAAATGATCATAAAAAAGAGTTTTTTTCTATTGGCTAATATCATTCA
ATATATAATCATTTCTTGACACATTCCACCAAATTGTAATAAAAACCTCGCTTCTATTTACATCAATTCTGCAGTTTCTAGCGTAAAAACTATTGATTAG
ATTTCACGGTGCCTTTTGGATGACTAAAATCAAACACCTTTTGACTTCACTGCGTCATGAAACCCAAAACCTCTGAAAAACGACCAGACAATTATCAGGT
TATTTCTATGGTATCTGCAGTTAAATG