Description :
From Genome Similarity Track
Location :
Scaffold_104:40811- 42568
Transcript NameFunction/comments
Phyci_341461Hypothetical protein
Phyci_12788Hypothetical protein

Sequence
1757 bases(100 bases per row)
CTCAGCGGTGCAGCCAGCCGGTGGTACATTGCCAACTTACACGACAACCGCTCTCGTTCTTTTGCCAGTCTCGGTCGCTCTCTCAAGAAAGAGTTTGGAT
CAAAATTATCGAAGGCACAAATCGGTCAGATGGTGGCGGCCAAGCGAAAGAACCCGACTGAGACGTATCGCGAATACTCAATTCGTCTACGCGCGATGGC
GGCGGCATCAACATTCGATGGACTGGAAAGCTGCGACTCGAACAATCTAGCTCTAAGTTCGTTCATTTCCAATGCGTGGTTCAAGCACGCCGATAACCTA
CGGATGGTCATTCGACCAGACTCCAATCATCCCCTAGAGGAACTGGACAGGGCCATTTCGAAATTATGTACGATTGCCGGATACCAAGGTATCATCGCTC
CGAGCTCCCGTCATGCAGTTACACCAACCCCTCCCTCCACCTCGATTACGGGGAAGCGAGAGCAGCAAAGTGGTGGGTCCCTGTGGGACAACAGATCGAA
GAAGAGGGATTTCTCAACTGCGCGCTGCGGTATCTGCAAGCAACTGGGCCATACAACCGGTTTCCACGATCGCTACGTTGCCCGGCAACAAAGTGGACTG
GCAAACGTCGCGCGTTCTGTTGAAGTAAGTATGTCGAACTCAACGAAAGAAACAACTAACAACGATGTTTCACTTCTTCCAAATGACGACGCACGCGCCT
TTGACTGAAGGTCACGGGAGCCATCGCAGCAAACTACTCAGACATTTGATCCTGGGATCAGCGATGGTGCCCCGATTATCGGCTCCGGCTCAACGTACCA
CATCACCGGATCGAAAGAACTCCTATTTGACCTACAAAGTTGTGAACCTCATGCTGTCGAAATTGCAGATGGTGGAGTCCGATGTGGCAATGAAAAAGGC
AAAATGGCAGTGAACGAACTCAACGGAACTGTGCTCGAGAACGTTGTGTACGCGCCTGGGTTCTCTCAGACACTCATCTCAGTAAAACAACTCATCGACG
CGGGCATGAAAGTCGAATTCACGGACAAGGAGTGCCTAATCTACGACAAACCAATCACGTGCGGTACAGTCGACCGAGGAGTCTACAAACTCAAGATACC
ACGCGCAATGGCAGCAGCTGCAATTCGCCCGAACTCGATTGAAGACTGGCACCAACGACTCGGGCACCTGAACTACCGATCAATTGTCGATCTCAGCAAA
TCTAACTTGGTGAAAGGTCTACGTATTGTTGGACCACTCACACCGTCCAAAACGTGCGAAGTGTGCGCACTTAGCAAAATTACTCGAGCTGCAGCGCCCA
AGATCGCGTCAAGACCTGCGAGTGCACAAAATGAAATTTGTCATGGCGACTTAGGCGGACCTTTCCAACGGAGTTATCACGGTGATCGATATTACTACGC
GCTGAAGTGGAGAGGCCACACTACCGTGTACTTCCTGAAAACAAAAGATGAAGCCATCACATGCTTCCAGAAGTACATGAACATCGTCAATCGACGCTTC
AGCAGAACGGAAGGCCCAAAAATCTATAGGTCGGACAACGGCGGCGAATTTTTAGCTAATGCCTTTCGCAAAGTGTGTGCAGCAGAGGGTTTGGCCACTG
AAATGAGCGAACCTGAAGTCCATCATCAAAACGGCGTAATAGAAAGAACGCATCGAACACTTGCTGACGCAACACGCTCACTAATACTTCCAGCTAAACT
GCCCCACTACCTAAGGGAATACGCCGTCCGAAGTGCTGTGCGCACGAGAAATCGTGT