Description :
From Genome Similarity Track
Location :
scaffold_882:4081- 8282
Transcript NameFunction/comments
g10531.t1 hypothetical protein PHYSODRAFT_564322

Sequence
4201 bases(100 bases per row)
AAGTACTAGGTCATCTCAAAGCCGGCGCCGGACGAGATGGAAGTGAGCAGCTTCGCTCGAAGCACCTTGTACGAGGAGTACGTGGGCAACTTCAGAGTGT
TGAAGCACGTCGAGGAGCTCGGAAGCAGTTCGTCATCGCTTCGAATGGGGATCTTCTGCACGCAAAACTGGGGCGTAAGTGAAGCAAAGCCGAGGGATGG
AGCTCGTTGACAGCTCGTGGTGAAGCGCAAGAACGCAGCCTGTTCGGACGGCGTAAAGCTTGCCAGCGCCTGCCACAGCCATGCCACGCGCTTGTCCAAT
GCGAAATAGCCACCAGCGTATCGGGAGTTGGCCTTGAGGTCGTCCACGTCGATTTTGCCGCTCTTGCCGGAGATCAAAACTTGCAGCTCAGGCTCGTTGA
ACATTTGCAGCCAGCGAGGGTCGATGAGGTCTGATAGACCCATCCGGAAGGCTGCGCACTGCTCACGGATCTGAGTGTTGAGATAGTAGTTGGCCACAAG
GTGGATGTACCGAGTCTTGTTTCGATTCGTCACAGGTACGTTGCCCCCTCCAGGAATGATCTCGATCTCCTTTTGCTCGCCGAATACGTCTTGGACAACG
GTGTGTGTCAGGCCTAGGTCCTCCACGTCTCCATCGTAAGACTTGAGGAACATCAGATTCTACAGTACAAAGAATAACATTAGCCCATGTTTTTGCAGAG
TTTTGGGATCTCAACAGAAACGCACCTTGTAAATCTCTGGATCCAGTGACGGAAGTTCGTTGAGCTGGTTGAAGGAATGGAGAAGTTTGGAGAGGAAAAA
GTGGGCGAACTTCGGCTGAACCACGATGCCCTCGTACAGAGCTTTTCCCAGGATCCGACCGACAAACTGGAACATCGTTAAGTGGTCACTCTCGCGCGAA
AAATGGTTTGAGGCCGAGTTGGGGTTGGGATACAGCAGTTGGTCATGGGTCGTGAGGAAAAGTCCATACTGCAGGTCAAACGCAAGCGTCGACAGGTCCA
GCCAAAACTCTTTGAAAAGCCCGCCAGCATCGATGCCCACTTCCTCGCGACCAGCCGAGTTCACGAACACCACGTTGATCCGCTTCTTCAAGTTCGTTCG
GATTGAATTGAGCTTTCTCAAGCCGTCTTCAAGGATGGCCCCGCGATGGATACGGATCCGATACACGGAGCAACCTTCGCTTTGGTGGATTTCCTTGTCG
GCTTTGATGAGACGCTGGAAGAGTTTGACACGGTCTGGGAAGGGGACAAGATAGGGCATCGACTGAATTAGCTTGTTGGCTCGGGGGGTGCCTAGCAAAA
CTTCTTCAATGAGCTGGTTGCTATCGAGCTCAGCAATGATCCTGCGACGCATGAATATTAGTTACCATCACTTATCTAGATTGATTATCTTCAATCGGCA
GCGTACCAGCTCGTAACATTGCAAAAAGGTTGGCGAGAGCATCGGTTGTATAGAACTCTCATCAAGCGAGTAGCCATTTCAACGACGAACATTCCAAATG
CCACTGATTCAGAAGACGGAGCGAGATTGGCGTAGTTCCAGTACGCCTCATTCAGTGCATGCTTCAGACTCAGAACGATCCGTTCGATCTGACAAAGAGG
CAATGGGTACTCTTGCTCGTACATCTATCACAACAAAGTTACTTCCGTGTACCTTGCCAGAACATTGAAAGACAAAATAGCTCACCTCTTCGTCGTCCAT
TACGACCAGAAGGTGCTCGTAAGACATACAGAAAAGCACCAGCATGCACACATACGGATCGGAACTGCACGCATGAATCAAATCCACATTCTGTCACGCA
TCACGGCGTTAGTCAGTCACACTACACAGCACCAAGGAGAGGGGGGGGGTACCTTGGCAAAGTCCTCAAAATTCCTGGTGTCTTGCAAGACACACCACAG
CATATGAACCAGAGAAACGTTCTGCATCGCATTCCCATCGCTCTCCACAACCTCGACATGGTAGAAAGCCAGCGTATTGAGTAAACGCATTGCGTAGGAC
TGCCGCTTTCCACCATCGTTTCCCCATCGAAAGAGGAAGGTACCGCACAGGCACGACAGGGCCTTAACGTTCTCCAAGATGAAAGGATAGGAGCTTCTCG
ACAGCTTCATAGTCGCTGCACGCTGAACCATAGTGGACGGTGGCTTCTTGGCATCGTCAACTCCGTTCACAGCAATTTGGCGGGCATGCTGGGAGGTATT
GTGGAGATGACCAGCTCGATCAACACTATGATTCTCTTCGCCGTCTTCCCGTCGACGACGAAGTCCAGCCTTTTCGAACAAATTCCGGGCCCATGTTGCT
TTTCCAATAGATTTCATCTTCTGCCACGTTACTGAGAGAGACGTTGACAACGACGAAGCCGAAGCAATGTCGCCAAAGCCGAATTGTTCCTAGAAGCAGG
AAAGCGAATAAGCATCAGCTTGATGGGCAATCTGGGGTTAAATGGACGCACTTACCGCAATCGTTGGCGCTTCAGGATGCATTGGTGTCGGCCGTTGTGT
TGCCAGCGGGTGACGAAGAGCACCCGGGGAAAAAGAAAGAAGGTGGTTGCATATTGAGCGCAGGTACTGATCATTAACCAAAATTTGTAGCTGTTCGTTC
AAGGCTTCTGGAAAAACCACGGGTACGGAGTGAGATTCGGATACTTTTGTCCACGAAACAGCCACCCCCGACGCAGCGTACGTTGCGGGTGGGACAGACT
GAAGGAGCTTTGAAAGGAGCTGGACTTCACTCAACACAATCGTGTCGGTTTTACCCTCCACGCTATTCATCAACAATGTGTCAGATCTCCAATGTGATGG
CCCATGATATGCGTATTTGAAGCGACTTACCGATCAGAAATCCAAAGGATGTTTCCGAGAAACCAAGCCTCGGACGCAATTCCAGGTACAGGCGAGGCAG
GGAAGTCGAACACTGACAAGTGCAGCCCAGCACTCAGCAGTCGATTCCATAGCGATAGGTTGGTGAGTTGAAGCAACCGATCTGCAGCTACAACTTGGTT
TAGAAGTGGCACTGAAAAAAACTGATAATAAAGAGCACCAATGGTTAGAAATTGAAACAAAAAAACGGAGGTATACAACCGCCACTTACTTCCATCACAA
ACGCCTCAAGGATTCCACTGGTCGTTGTGACAAGATGCACGACAAAATCCACCAGCGCATTACAGTACGAGGACTCCTTCACACGGGACGATATTGGCAG
CGGTCCACGTGATGATATCAATCCTTGTCGGACAATCTGGGTCACAGAAGCTGTGCGCATCTCACTGTACAGCATTTTCCGAGCTTGTTGCTCGTGAAAT
ACAAGCAATTGGCCAGACAGCAAGTACTGCTGTATCTCCGGCAGCGTGTCCATCAATATCCGTACAGTCTTAAACCCTGCACACACCTCCCCTGCTGACG
ATGAGCTGCACTGTAGACACAAGTCCACAAGTCGTCGCAGCTGCCAGCATCTTTGCCTCTCGCTCCCTTTAATCCCGTCAGAAGTTGCAGCTAGAGCGTC
TGCAAACAATGAACTCAGCTGCAACAGTCTCTCAGCGTCTCCTTCACTTCCAGTGTAGAAGAACACAAGAAGACGCAGCAACTGTAGCAACAGCAATAAC
ACAGCGTTAGTTATTTTTCTTGACCCCGATTTCTGCAGCTTTTACCTCGAACAACGCGTCATAAGGTAGCGGCATATTGGGCAGCTGCAAAATGGCCTTC
AACTTCGAGATGTCGCCCAATTTCTGGTCGAATTCGGCGCGCGAATGCGTCCGCTGCCTTCGAGCAGCGAGACGTCCACGTACAAAGGTCCGCAGCTTCC
GTGCCGCCGCCTCCTGCTCCTGCCGCCGACCTCTCGCCTCTCGCTGCTCTCTCGCCAGCTGCAACACGCGCACGCGGTCGTCCCGCCCGCCCCTGCGCGC
CAGTTCATCGTCCCGCAGGAACATCTTCGCGTCAAGGTCAGTTTTCACACAAATCGTTTTTGTTTTCAACCAATTGAATTCAAGAAATAAAATGGAAAAG
TAGCCAATCACTGCTTCAAGTTGAAGCGAGCTACACGTCGTGTAGTACGATGCACGATGCCATAAAGGATCGCGCATGCGATCATCAGCACGGGTGTGTC
CATCATGTGCGGGGCCATAGCCTCCGCGTACGCCATCGTCGGCGCCAACATCAGCATTAACAGCAGCACCTGCCAGAAATTGTCGAACGCCGCGTAGAGG
A