Description :
From Genome Similarity Track
Location :
scaffold_897:4081- 5491
Transcript NameFunction/comments
Pl_101942Amino Acid/Auxin Permease (AAAP) Family

Sequence
1410 bases(100 bases per row)
GTACACGACCATGTCGTAGCCCGACGGACAGTAGGGGAATGTCTTGTCGCTAACGATGTCGAGGAACAGGTTCTTACCTGTCGTGTACGTTACGTACCCA
CCAAGGCCAGCGCAGACGACGATGATAAATGAACCGATGGCCTTCTCGTACCAAGGAGTGCGGTTCCAGAACACCTTGAGGTAGAAGAAGATTGGTAGGA
TGATGCAAGCCATCGACACAGCCCAAGCACCGACGAAATCCGTAAAGTCGACGAAGTGGTCCTTGAAAATGATGGAGATGATGAGGAGAGTCACGACGAT
GACAATGCGGAGCGTAATGTACTTGGCGGTGACAAGAGGTCCGCTGTTGTGGTACTCGTCGATCAGAGCCTCTGGGGACAGATCGTACTCGGCGTCAGCC
AGCGACGTGACAGATGGGCCCACCACAGAGGCACGGTCCTTAGGTTGCGAAGGTGTGTTGATCACTTCGAACGCCGGGGACTCTTCATCAGCAATAGGAA
GGTTTGGACGTTTGTGCATGCCCAGAATGCCGCGCTCAGCAATGTACAGCACGGGATTCAGGATCACGGACATAGCGATGGTGATGTGCAGTTGCATGAA
CATGTATGCAAGCACAACAGCACCGCGGTTGGCATTCAAGTCGAGCGCCGTGCCACCGATAGCGAAGAGGAGGTTTCCCGGAATCTGACACCCAACGAAA
GAGTACGACGTCGCACCGATGATGAGGAAGAGGCAAGCCGTGAAGATCATGGTCGTAGCAACAACACGGGGCATGCGCTCAGGCTGTGAGTGCTCACGCT
GCAGAGCAGGCACCAGTACAGCGGCTGAGTAGGCCAATGCCAGGTTACCGAACGAACTCGCGGCCTGGCCAAAGTCGAAGTCGGGGGTAATCACGGACGG
GTGGTCCGAACCGATGCCGTTCACCAGCACACCGAGAGCGATGGCATCAGCAAGAAGCGTGCCGAGGCAACCAGCAAAGGCAGCAGCAGCACCCTCCTTG
AGAGTTGGAGTAAGAATCACAGGCAACAGCATCGCAGCCATGATAATACTCCAGTATTGTTGGTCGAATGCATCAGGGGAGATACCATCAAGCAGGATTC
CACCAAGCACCAGGAATGCGGTCGGCACCAAGCAGCATACGCCGAACTGGACGAAGAGCACGAGGTAGCGACCAATCGGACCGCAGCACCACTCACCGAC
GTCACCGTAGGTCTTGACAGTCTTGGGGGCTGCTAGCATGACGCGCGAAATAGCCACGCACGAGCAAATGTTGGCGAAACCCATGAAGACCAGCGCGATT
GTGGTGATGACGGCACCCGAACGAGCAAAGTTAGACGGGAGACCCAGCGTACCGATGCCATACACGGTACAAAAGAAGTTGAAAGAAATCTTGAGGTCCT
CAGTAGTGAA