Description :
From Genome Similarity Track
Location :
Scaffold_1994:4081- 5389
Transcript NameFunction/comments
Phypl_g14518hypothetical protein

Sequence
1308 bases(100 bases per row)
CACGTCGGTCTCAGATCCCTCCAGTGATGCGTGAGAGCCGCACAGCGGTCCTCCGTCGCCGACAGTTGGCCTTCGAGAAGCCCGGTGCTCTGcctctcca
gcgccatggcggccCGGGTCCGCGCAACAAATCCACGGTAAGCAGTTAATGTGTAGACATCCAGTCGGCACAGGGACTCTTCCCACTCCTGGTCCGCCTG
GACCCGAGCCGCGTCAGACCGCTCCAAGGCCCGAGCCaaccgcgtgctggcgaTCGCACTCCGAGGATCAGCCGAAGCGGCGCGGGGCCGGACGTCGCGC
AGTAAACTCAACTGGTACAGGCTAGCCCGGAGCGCACCGAGCGTGTTGAGCACTCGAAAACCAAGCCGGTCCGCGCCGAACACGTCCACCAACTGTCCAG
CCTGAAGCTCAGCCGCCCGCGTGCGCCTCTCTGAAGGCACCGTCCCCGTGGACCCCGAGAATCCTTGAGGAACCAGGACGTCGACGGACGATCGATCAGG
ACCGGGAGCCAGGGACGCCAACGTCTCAAGTTGTGCCACAGTCAACGACGGCACTCTCACCGCCACGTGCGCGACCCCGTCAACGTCTCGGACTTGAAGA
CCTCGGGGAGTTCCAACGGCGATCGCTTGGATGTccgcggccgacgccggGAGGTAGATGTACGGCGGCGAGAGCACGGAGGGACCAGCTAGCTCAGCCA
GACCGGGTCGAACAACGTCACCGGTCAGCAGGGTGACGAGATCGTCTTGCATTCCTAGCGTCCCAGACAGCTCGGGACCAGCAGATCACGTCGATGAAGC
CACCCCGAACTCCCGACATCAAGTCGCGTGAAggcgtgagcagcgcctggcgAAGGTCCCGGTCTTGAGGCGTCAAGGCGGGCAGGGGCGTGCCAGCGCC
CTACCAGCGCCTGTGTGTCCGCGAGCTGAGACACAACCCCGTCCGCAGGAGGGCCCTGCGGAacgccgtgcagcacgtgcgaAGGAGCGGCGTGCGCCGG
AGGAGCATCTGCCGGAGCCGAAggagaagccgaagccgaagtaGTCACCGGCGAGGCGAGTCAGTTTGGAGAATGAGCAGCCCAAACGGAATGGACTTTC
CGTCAGGGACGGGACGACGCATATCACGGGTCCTGCCGTGTGTCAAGCCCCAAGAATAAAAGTTCCCAATCACGACTGACGGATATCGACCACGGTCGTT
GGACCCCGGACTCGGAGTGACTCGGCCGACGACCCAGCCGATGCTGATGGGCCCCGAGACCCCGGAGGTACGGGTCAAGATCCTGAACCCCAATGCCTCG
AGCAAGTC