Description :
From Genome Similarity Track
Location :
Scaffold_1445:408- 2030
Sequence
1622 bases(100 bases per row)
CTATACTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTTGTCTCCTGGGAACTTATTTCCACAGTTGGGTGGGAACTTATTCCCTCACTAGCCTC
TTGGGCTATCTCATCATCTAACACGAGTGGAATTGCTCCCTCGTTATCCTCTGGCGGTGGTTGCGCTACCGCGGCCAGGACTTCTACGTGCATTTCTCCA
ATCGCACTAAGATCATCGTATTGTCAATCATTGACAATCGGTTCAATTTTAATTGGGTGTTGTCCGTTTGGAGGACACCCATGCCCCAATCCACTCGACT
TATTCGGGTGGTGGGCCTTCGGCGCGACCTGCATCTCGATGCAGTCGCCGGAATCTGGCTCCATGGTGTGGCGATCAGCCACTCCATGGCCATGTGCAGT
CGTACTAACGATCGAACAACACGCGAGGCCATCGCACTCGCTCGTAGTACACCCACATGTTAGTGGGCGCTCCATGGTGTTCATCAGATGGCCATCTGGT
GAACAAGTGACAGGCATATCGACTGTTCGTCGATGCCAGCTGACTTGTGGCTCGTACCTTCTGATCCACGGCAGTCCAAGGATGACATCAAATTTGTCAT
CCAAGTCTAATATGATGAAGTCATCATCGTATTGGACTCCCTTCAGTGTATAGATAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCTC
GAGGCGCACCTTCATCCTCGTTGGAGGGATCTCTCGCTCAACATATTCGAGCTCTCTGTTGTCTAGCGATTGGCGTATTACAAAGTTGTTCGACGCCCCA
CAATCGACTAGGGCTCGAAGCGACATGCTTTGTGTCACTTCGAGTTTCAAGGTAATGAGTGAAACCTCATTACCAGAAGCAGCAACACACAATGACTGAG
TGTTGGGAGCAACTTTCGTCAAGAGGCCTGAAAACTCACTTGACGTTGCTGGATAAGTAGGGTGCTCCTCACCTACTGACCCTGACTGTTTTTGGCTGTC
TGTTACGTTGTTGCGTTTTCGCAACAACGTCGGACCCACGCCTTGGACCTCTCTTGGCCGCTTGGCGGTTACTGTTTCCTGCGGTACGTGGTACCGCCGT
CGGGCACTGCATTCATATGCGTAATTCCCTGTCTTCTGACATTTATTGCATTTCTGCAATCTTATAGTTGTTAGCACGGGAGCTCTCGCTCCTCCAGTTA
CAGAGGTCCATTGGTTCTGGGCCTCCATCTTCCTGTCGTCTCGACGGACGATAGGAATTCGAATTCGCGTGAGCCTTTTTCACGCTGAAGTCTTCCTGTT
TCGCACCCCTTTCGCCTCTTCCAGGGTGTTGAACTCCAATCGGAACAGGTAGGTTTTAACAGGACCATCAGTCAGACCCTGCATGAACAACGTAATCAAC
GTGTGTTGGTTCATTGGGTCGACTGTTATGCAACTGGTAAGGTGACGTATGTACTAAATGTACGAGTGTACGTCACGTTTACCTTGCTTGATTCTCACAA
GTTCAGAGCAAGCCCTGAACTCAGCTCGCGGCGGCTCAAAAGTTTGCCTTAGCAGGGAGTTGAAGACATCCAACGACCCAAAGACATATGGGTCGTGTAA
CTTAAGGCCCAGGCCCACGTCT