Description :
From Genome Similarity Track
Location :
Scaffold_1253:408- 1492
Transcript NameFunction/comments
g16728.t1hypothetical protein

Sequence
1084 bases(100 bases per row)
ATTCATACGAAGTCGCTGCCTACGCACTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGAC
CAACGCCTTGAATCTCGATCTCGACGTAACCCTCGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGATACTGC
ACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAATTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCAT
CGCTGATGAACACGATGCGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCG
CAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCA
CTGATGTTCAGGGAGTTGAGCACCTCCTGCTCGAATAAGTTCCCGTCCTCGTCATCCTCCACTGAGTCTGTGGACACATATTCTCGAGCTGGTCCCGTCA
TGCGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATT
GTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTG
TCGATGAGCATGTCACGTGGAATCTTCATGTAGTCATTTCCCAGATCGTTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACG
CAGCCATTTCTGCAGCACTATCGGACGTGGCAGCCGTGCGAACACGCATGTTCTCTGTCAGACGCACCTTATGGAAAAGTGGCCACCGTTCGGATGACTT
CAGGCATGCGTCGATTGTCTCTGTAGCCGAGCCGCCCTTCACCACCGGGAGAATTTGCCTGAAATCTCCCTGAAACTCGACCAC