Description :
From Genome Similarity Track
Location :
Scaffold_727:4078- 6315
Sequence
2237 bases(100 bases per row)
GGAGACAACAGAGACATTAAATGTCCTAGTCAATGACGGATCAAGTATAGGAACTTACCAACTTGATCTGATCGCGCCTCCGAATACAACTTCGGAGATC
ACTCAATTTCCCACGCTCGAACAGAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCGTCGCGGAAGACGAGTCCGTAA
CCGATATTCGGTCGGCAATGGTATTCGCTGAGAACGAAAGGGTTCTCACCAGCTCATCAATGGACGAGAGTGTCCTTGATGAAAAGACTCGGATTGAGCT
ATACACACCCCAATCGTGGGAATCGCTCGAGACAATTCCTCTCTACGATGATTTGACGGAATTCAGGGATGTGATCCCAGAAACAGTGCCGTACCCAAGG
ATAAGAGTACTCGTCACGAGATAGACCTGAAACCAGAGTCAAAATATTGTGTCATGAAGCAATGGACATTGCCTCGTGAACAATTACTAGCGTTGACAAA
TTCTTTGCCGATCGCTTGGCAGCGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTGCGAAAGGCTACAGAAAGATGGCGGA
TAGTACATGCCTTCAACAAGTTGAATGCTGCAACTATACCGGCTCAAACGCCGATACCAAGAAAGGATGTCATTAAAGATGATATGGCAAGGAGTACCAT
CTTTTCATCAATGGATCTGATGAACGGGTTCTATTAGATCCTTGTGCGTGAAAGGGAAATCCCGTACACTGCAGTGAGCGCCCCAATAGGTATGCTTTGG
GAGTGGTGTGATGCCACAAGGGCTGAGTAATGCCCCTGCTACATTTAACAGATGCGTTACGAATCTGTTGAGATCGCGAGAATTCGCACCTAGCTATTTT
GATGACGTGTTCGTCCATAGACGGGCTATAGATGGACAGACGGATTTGGAAGTCCACCGGCTCCACGTCCGAAAGGTTCTTGCACTGATGCGTAAGCATT
AGTTGTATGCCAACCTCGAGAAGTGCATATTTGCTGCTAGCAGAATACCACTTCTTGGATGCATCGTGGGTAAGCACGGCGTCCGGCCAGATCCGGAAAA
GATCAAGGAGATCACTGACTGGCCGGTGCCTACCGACATAAAAGGACTTCGAAAGTTCCTTGATCTAGCAGCGTATTTGAACAAATACTCGCACAATTAC
GCCGAGATGACTGTTCATCTCTCTCGTTTATTGAAAAAGAACGAGAAGTGGGCATGGAGTGCTCATTGCCAGCGCTTCCTTCGAAGGTATCAAGCAAAGC
TTGATACGCTCGCCAGTTTTGGCAATTGCAGACCAAGACAGACCACCTCATGTGGTCTGCTATGCAAGTTATTTTGCCATCGGATGTGCACTGATGCAGT
GTGACGCAGACGGTGCTGAGAGTGTCGTCTGCTATCAGTCACGTCAGCTGCAACCGGCTGAAGTAACTACCCGGTCCATGATAAGGAACTCCTTGCCATG
AAGTATGCTTTGGCAAAGTTCAGGGTCTACCTGCTAGGCGATAGACCCTTCATCGATTACACGGACGATGCATCCTTTCGCACGGCCGTTAACAGTCCAC
AGTTCACGCAACGAATGACAAGGTGGCTGTTGTTATTCGCGAAGTATAACTTCTCGGTGGAATATAAGCCATGACGATTGAATGTCGTCGCTGATGCACT
GTCGCGCCGGCCCAATTTCGAACCGGCTGCGCAACCCGACACTGGTCCGACCACTGTCGCGGTGTTGAAGTCAAGTGTCCCGTCGTCAACCATATTAGAA
AATATACGCAAGGCGTACGATCCGGTGATGGTGTGTTTGATGGATCATCTCTCGCAACCATCCCGTCAATCCCTTAAAAGGTTGCCCCCAGTATATCGAC
CCTCCATGGATAGATATACAGTCCACAATGGCTTACTGAAGTATTCAGTCATTGCCGGCGACACACCTCGTGTCGTCGTACCGGACCATGGTGACCTGCG
ACTGCGTGTCATGTACGAATATCTCGATCCACCTACTTGTGGACATTGTGGTCGAGAGAAGTCATATCTCACAGTTAGTCGCGACTTTTACTGGCCCCGC
CAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTTAACGAGTAAAGTCTGCGCCGCTGCAACCCTTGCCCATTCCGGCGGGATACTGGA
CCTGTCTCATGACTTTGACTTTGGATTTCCCGCAGAC