Description :
From Genome Similarity Track
Location :
Scaffold_77:40779- 45899
Transcript NameFunction/comments
Phyag_g1668protein phosphatase 2C, putative
Phyag_g1669hypothetical protein

Sequence
5120 bases(100 bases per row)
ccacttcaacttcacaaCCATGCATTTTCGTCCAATCACACGCGTTTGTGGACGTAAGTCCCCTTGATCTAAGTTGGATTGTCGTCGAGCATGCGGCTTT
TTGCGGCGCGGAATCTGGTGCGCTTGGTGCGTGGACAAAGTCCCAAGGTGCGTGCAAGCTTCACCCCCTTACTCCCTCTATCTCTCAGTCGCATATCGCC
GCTTCCGCGACCAATTTTGGCCCCGCAGAAGCCCCACAAACTTCCGTCCACACTCACGCTTCCTCCCTCTTTATTCTTCCCCAGTTTCATGGCTCGACGC
TGCgtcaggcgctgctgctaagTGGATTGGGGCTATCAGTACTGGCCATCGCCCACGCTGAACTTGCAGACACGGGGGTGGCGCACTTGGAGGCGCAGTG
CGACGCCCGATACGCCCCGCCAGAGGTGGAAGGAGCCTTCTCTGTGCCGCTCGAGCGCGAGGAGTTTGCGCCCATCGCCAAGTCGCGCGCCACGCGgctc
agcagcgcgtcgtacAATGCCAACTTCCCCATTGAGGACAAGTACGCGGTGGAGACGACAGACTCAGGCGacgtgtttgctgctgtgctggacgGCCATG
GTGAGAGCGTGCAGTAGCTGAGCTGGGCCTCTTCCGCCCGCCCCTTTCTGACTATTATTTTTTATCTTGTGTTTACAGGAGGGTGGCAGGTGTCGGAGTA
TGCCAGGAAGACGCTGATTGGAAAcgtgcagaaggagctgtcgTATCTGTACAAACCGGGGACAAACGAGCCGGCCCaaggcgacgagaagacggTCTCA
GACGAtcgcgtggctgctgctatccAACGTGCGTTCGGACGCACAGACCGCGATCTGGTGGCTGAAGTGGCGTCGGCTTTCAAGTTGGGATTCGGAGCTG
TCGCACGTTGCGGATCTTGCGCGTGTTTGGCGTACGTACACGAAGGCAGCGTCCACGTTGCTAACGCTGGTGACATTCGTGCCGTGTTGGGAAAACTTGG
CAAAGATGCCGACACGATGGTAGCTGAGCCGCTTAGTAATGACCAGAATGCCATGGTGaagttcgagcaggagaagctgatCAAGGAGCACCCAGGCGAG
GCAAACGCGTTCACGTGTCGCCACCCGGATTCTTGTTACGTAAAGGGCGCGCTTCAACCCACGCGCGCCTTTGGTGACTTCTCGCTCAAGCACCCGGAAT
TCAATGGCCCGCCGTACGTAAACGGCGATCGCTCCGCTGGCCGCCACTTTTCGGCACCGTTCACGCCGCCTTACATCACGGCTATCCCGGAGGTCAAATC
GCACAAGCTGGCGGAGGGAGACAAGTTCCTCATCATCGGCTCCGACGGGCTGTGGGACTATCTcagcaacgaagaagctgttgaggTGGTCAATGGCCAG
GCTTCGTGCGGAAACCACGACCTCGCGGGCCGTGCGTTGGTTGAgcgtgtgctgcagaaagCGGCGAAGCGTTACGGAATGACGTACCAGGAGTTGCTGA
GCCTTCCGCCCGgaagccatcgccgccgtcgccacgaTGACACGACAGTGGTCGTGCTCTTTTTCGACTAGAGTGAATTGAGACTATTCCTGCTGGGTAA
TCTTGATGTACATGAAGGAATGCAGAATAGGCGAGCATAAAGTCCACATCAATGGAGGTCTTTCAACCTCATTTTCTTTTGCCAGCTACGGGAACTAACT
TGAGCTGTGAGCATTGCGTGGAGATGAAGGTATAGCACTTCTAGTGACGCTTTGAGATAGTATGGGTACACTTGGAAGTGCAGTTGTCGACGGGTTCACT
GATACACTGGTGATTCCCTTTTCCTTGTTCAGCTGTTGCCTGTATAGTTCGCAGTTTCTCTCTAGCGAGTCTGTGTAGAACTGTTGGGACCATAAAGTGC
GTATCAAAAGTAAGCAGCAATGACAACCCAACAAACATGTAACGTACCCGAAGGTGGTGGCAAAGCGAAGTTAGCGGAAGCCAAATCGGACGTACGACGT
agttgatgaagttgagctGCACGGTAATCCGAACGCGTTTGTTCTCCAGATTTTGCATGAAAGAGTCGGTGGAAACTCCATGATCGGCTTCGATAGTGGC
TTGGTTTTGAAACTCATCAAGCAAGCGTGCACCCCACTCTTGAGCCTGAGCGAACGGTAGCGTGTAGTGCGATAAGTCAGCAGCGTGCATGAGAATGCCC
ATGAAAATAGGGCGTTTCTCGCTGAGTTGCCGACGTGTAAGGCCTTCAAGGGCTTTGCATTTCTCGAAATGCTTGGATGTGTCGGTCGCGAGAATGCAAG
CAATGATGAGCTGCCGCACTCGTTTGTGGCGCTCGCGATCCAGGTGTTGCAGGATCTTGGCGGACTTGTGATTCAGGATTATAAAGGTTACACggcagtg
gtggcgctcTAGCACCGCGTCATCGTTGTGGGTAAGCGCCATGGGACTCatcatcttgagctcgaagtCGTTTGTATTTCCTGGATGGTCGATATCATGG
CACAATGATGCAACGAGCATCGAGAAAATCTCGAGGCCACTGAAATATCGTCGACACTCACTGCGTAACATGACGTGCATCGCTACCATAACCTGAAAAG
CATGTTGAAAGTTGTGGAACGGGTTGCTGCGATAATAGTTAGCCACGTTTGTCGTGAATGCCGAGAATTTCTCGCTGGAGATGCGAAATGCATCCATAAA
CCCGTATGCGCGGAAAATAATGCCGCAACTCATCGATACTTCACTACTCGAGAGCGACACTGTCTCGGTGTCCCAACGATCCAGCGGTTCGTCTCGCCCA
TGAGCGAAAATTATTTCGCGTGGAAACGGCACtacgtcgtcttcgtggcTCTTTTTCTTGATAGCGGGAAGCAGGGCTGCGAAGGAGGCTAGTCCTTTTT
TCTTAATGACACctccgccatcgtcgccatcacCCGAGTGGCAGTACTTGTGCACGATGGATGATATTATGTCGGTCTCTGAATAATTGTCCATGCGGTT
TATGGCCGACATTCGCTTCAAAGGCTTGGGGATCGCATTTGCACCAGTCCGAGAAACTGCGACGCAGTCTGACACGACTTTGTAGTACGATATATCGAGA
GATAATCGGCCGAGTGCAAATTGCACTTCTGCGCAGTACTTGCTCATGATGTCACGATCCGTTTTAGTGAAAGCAACGACGTGAGAACCTTCCTTTTTGT
TGATGCACATGGCGACAGCAACCACCTTTGGTGGGATTGTAACCGAGTGGTCTTCAAATACAGGCATGCAAAGGACACTTGTTGTCCGGTAGCCCGTCTT
CATATCAACGCTTGGGTCGAACAACTCGTGCTTGTAGGCGTCGCGGGTACAAACAGTTTCACCGGTGGTAGCAACAAGCCCAGAAATCCCGCGATTAATA
GGAGAACGGATGCTTTCACCGCCCACGCGTGGCGTGATCCAAAGTTCGTGTTTGAAGTGatcgatcagcagcagcccaaaGCGATCACAGTCCATGATAT
CTTTACCTAACTCCATAACCATGTCCACAAATGCAGCAATGTCGGTGCTCTCTGAGATGAAAGTGGTGAGCTTCAGTCGTGCCTCAATAAGTTTCTGCGA
TGTCTTGACCTCGCGATGCAAACTTGCTTTGTGCAGCGACGTTCCcactgcttcagctgcgtAATTAAGAAAAACTGCATCCTCGCTGGTGAAATCCATT
CCGTCAACCTTATTCACTGCTGAGAGAACCGCCAGAATGTCCCCCTCGGGAGATTTGACTGGTAGACACAAGATACGCTTCGTGAGAAAGCCTGTCTTTT
GATCTAATGTTGGGTCGAACAACGGGTGCGAGTAGGCATCATTCGTGACGACGGTCTCTCCTGTGCGAGCTACATACCCTGCGATGCCTTTGCTGATCGG
CATGTAGTCACCTTTGGCGAtatctgctgcagaagataTATAGAGCTCGTCTTCGCCATCCACCTTTATGAACAGACCGATACGCTCGGTGCCAATAAGT
TCGTGGCAAACCGCAAGCACCTCGTCCAGAACCGCAGATGACGACACGCTCTCCATGGAGATGTTACGGTGTAGTTTCAGCAGTCCTTCGATGCGATGCT
GAGCAGTCTGCCGTTGGCGTGAAAGCACTAAATTCCAGATTGTAGCGCCGGctacgacagcgacgaactCCAGGTTGGTGATGTCTGTGTCAGTGAATGA
TGCTGGTGTCAGGGCTGTTTTATCTGATATAGCAGAGGCGATTGATGTCGACTTGTTCATAGCAATCGCCTGCAGCACGCCAACTATTGCTTGATGGGCG
TTGTGAATCGGTAGACATAATAGAGAGCCTGCGCCATTATCTCTTGCATTTTGTTGGCTCTGGAAAATTTTTTGCGTGTCTAAGTCGTTGATCGCAAAAG
GCCGCCCCGTCATGACCACTCGTCCGAAGACTGTCGGGGAGTCAGGAACCACAAAACCTTCATTGATGACAGTAACTTTAGCGGATGACAAATCCAGgtc
agcgtcagcatcgTTACGAAAGGCCGAAAACACGTCCAGAACATTTCGGCGCTCGTGTAGGATACCTTCGTCAGCAAAAGAATCGAAATGACAACAATGT
ACCGCAATGAGAAAACGAAAATGAAAACGTGTAGGATACCTAGAGTGGACTTGTCGGCGCGCACCAATTGCAGTGCGGCACGCAACGTGCGCTCAACAAC
GCTCTCAAAGCTGCTCTGGGCCGAGACTTCCTTGCCTAGAGTCATGAGCATCTCCAGCTGCGAAACGCGCTTCTGCATCGTCACGATGCCGCCTGAAGTC
TGGTCTGTTTCTGTTGTGGTAGAAGACACAGTCGATTGAGAATTGGTGCCGTCGTTTGGTCCGATCTTAGGAGAGCTAATGCCGACATTTCCGCCACTGT
GTCCGATAGTACTTTGCCGATGTTCCAGTAATCTTGactccaccgccgccgatCGGCTACGAAGCAGTTGGACGCGCTTCCGATTTTCTTCAATTCGCGC
AAGCAGACGTtgcttctccgtcgcctGCTCGCGAACGCTATTCACGACGGTCTTCAGAGCGTCGACGGGAACGAACACCATCTTGGCGCTCTCCATGGAC
GGCATGGCTGCGTTGCGGAT