Description :
From Genome Similarity Track
Location :
Scaffold_394:4077- 5918
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_394-abinit-gene-0.37Serine/threonine-protein phosphatase

Sequence
1841 bases(100 bases per row)
AGTCGCCATTGAAGAGATACCACATCTTTGCGCTCGGCACGCCGTTCTTGTCCAGGATCGTTAGCAGATCTTCTAGCTGACCGTGCAAATCGCCGACAAC
GATGAGCGTCACGCCCGCTGGGATTTCGATCGCGTTCATCGGCGACGCGTGCAAGATGCGAAACATCTTTTCACACTCCTCGAGAATGTGGTGCACGTAC
ACGCGATGCAGCAAGATGCCGTTGCGGAACTGGTCAATGAGCTTCGTCACCGTGTCCAGGCGCAGCGGGAACACGACATGCACACCGCGGTAATGTGCTA
GCGAAGCGCGCATTTTGTCGTTCTCCGATTCATCGTCCAATGGAAACTGGAACGTCTCGAGCGAGCCGAGGTTCGGCACCATAGACCGCAGCTCCGTGAT
GCTCGTCGACTTGTTGAGGATCTTGACCATCTGCACGGTCTTCTGCTCCTGCACGGCCTCGAGCAGGTTCCACGTGCTGAAGTTAAGCTGCGTGCGGAAG
AGCGACTGCGAGAGATGCATCCGGATCGCGTTCTTGATCCGGTTCGCCGAGAGCACCGCCTCCGAGTACAGCTCTACGAACTCAAGCGCGAACCTCTTCT
TGTCGCCGCTACGCTCGAGCTCCACGTTCACATACGCACGGGCATCTTCGGAATCATCAGCCGCTTCAACCTGCACCACGCGACCTGGATACATGCCGTA
GACGAGCACGCGCGTGTCCATCTTGAGCGACGACCGCTGGATGCGGACCGGCGAGCAGTCCCGGCAGATGCGCACTTCGTCATAGTAGCCCTGCATGGGC
AGGCGTGGCACAAACACGGAGCACTCGTCGCACATGCACGTGCCGCACTTGCTGCAAAGCCATAACAAATACGATCAGTTAAATAACCTCCCAACTCATG
CAACAGACACAATAACGCACAAACTCCCTTCAACGTACCGACAGTGGTGGGCGCGGAAGAGGAACGTAAACACCTTTTGGCACACGAGGCACGCGGGCGT
GTTCTGCACCCAGATGGGGCGCAGCGCGAGGCGGAACGCGCGCTCCCACTTCGTGTACGTCGCGTCGTTCGATGCGCGCAGCTTCCACGACATGAGCTGG
CCCGTGGGCGAGTACCCCGTGAGGTTCATCTCGAGCTTCCTGCGATTAAACATGAGTCCGCGCTTGATCAGGTCGGCGTCGTACTCATCCTCGTTCTTCG
CGAGCTCCTTAGCGTGGATCGACGCGTTGAGCATCATGACGCCGCGCAAATTCTCGGACGTGAGCGTGAGGTGCACGCGGCGGTTGCCGCCGAGCCCCGG
GGGCCGACCGACGGGTATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTCGTAGTAGCAGAAGCGCCCGTTGCGGAAGAGCAGGAAGTACCGGAAGTGCGCGTAGTCGCCGAGCTTGATGAGCGCGCCCTCCATGAGCTTGTGGT
CCTCGTTGTAGTTGTTAAGCGTCGGCTCGTCGTCCGGCGCGACCATCAGCAGGTGGCCCACGCCCCATCCGCCGCGCGTCGATAGGCCCTCGGTGTCCAT
CGTGGCCGACAGTCCGCAGCACTCGAGACTCATGCAGCAAGGCGTGTGGATGTGTTGCTGTTGTTACTGGCTGACGAAAATGAGACTTGCGGGTTCTCTT
GATGTGACGACGCCAGCCCCTCGTATAACCGATACCCGAAC