Description :
From Genome Similarity Track
Location :
Scaffold_1293:4077- 5692
Sequence
1615 bases(100 bases per row)
TCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGT
TCACCTTCTGGGCTCTAGGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGG
CTGTCCTTCTTCGCGGAATACAACTTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTACGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGG
CCCACATCACGCGGGTGGAAAACGGAACCTATTTTATAGTGTGCGAAAAACCCCGGGGGTAACCGGAAGAAGGAGCTGGTCCCGCCTAACCTCCCAGTTT
CCTTAAGGCCGGAAAGACACGCCAAGTCCCAATGGCTCTCCTCCCCAAGCGCTTCAGGGTTCCACGCAAATGTATGGAAGGAGGCCTCCCTCTATATCCG
GTGGAATCCACTGAACCTCCCCCGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCTGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGCCACT
TGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTGCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAG
CGGGTCAAACCCGCAGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTGC
CGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTTCAGTTCCCGTCACTGTAACGGGCGAACAA
ACCGCAAGGTTGTTCGTCGATGGAGTGTTCCGCTATCACGGTCTCCCGGAGATTGTCTCGGACCGAGACCCGCGGTTCACTGCCGCGTTTTGGATAGCGC
TGTTTCCTTTACTGGGAACTTGTCTGCAGAAGTCCACTGCGGACCATCCGCAGACCGACGGCCAAACAGAGCGCGTCAATCGAGAGCTCGAGGACACTCT
GCGCAGTGTGTGCGTAGCAGCACCACGTACGTGGTCGACGCAGCTTTCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCAAGGGGTTTACG
CCGTTCTACTTGAACGGCTTCCGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACGCCTCTATTCTAAG
TGGGGGAGAGGCTCGGATAACCCTTTCCTCCCAGGTCTCGGATGTGAGACCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAAC
ATTGTCAGCAGGGTCCGCGATGCCATGGCAGCAGCCCAAGATAAACAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTG
GGGACTTAGTGTTGCCAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGT
CCTGGCCATACAGGG