Description :
From Genome Similarity Track
Location :
Scaffold_219:4077- 5578
Sequence
1501 bases(100 bases per row)
AGTTGCTGCTGTTGGATTTAAAGCTGCTCGAGTTGAAGCTGGAGCTGCAGTTGTTGCTGTTGTTGCTGAAGCTGGGTTTGCTGAGGTTCAAACTGCCGGC
GAAGATGGAGCTGCTCTGTTTGTCTTGACGCAGGTGTTGGTGGAGGGACCAAGCTGCGTCGAGCATTGGTACGCTCAGGATTTCGGCAAACCACTTGTTG
GTTAGATACCATATTAAAAATTGACTTCATTACCGAAGTGGGCATGCGTCAGTGGGGGCACTTGGAGGCAATTTATACTTAATATTTGTATGGTATATCT
AACACAAGCGAAAGGGTTCAGAGAGAGCACGCGGTATCTCCGAAGGATTCGGAAGGAGCAGAGACTGAACCCCCGGGAGCAGCGTAGAGAGAGGGCTAGC
GTACGTTCACGAGCGGTACGTCCCCAGCACTAATGGCGAACCGCAAGAATACACTGATACTGCTCCTGAAACGCACGCACAGCTTCACCTATGAGCAGGG
AATGGCTGTGTTTGAAATAAATGAGGAAGAAGCAACTAGGTGACTCCCAAAACTGACAAAAAGGCGTCTCAAATCAATCGTCAACAAAATTTTGTGTCGT
TCTTTGTTAATTCCACGAAGTGACACATTTGAAACTCAGGGTAGAAAGAAAACTTCAGTAAAATTGATAGCAAGCAACTAATGCGAATCTATAAGATTCA
CGTTTACTCGTGCGAGTTTATATGAGTCGAGGGCCAATTGAAATTAACTCGCGCGAGTTAATTTGAGTCGAGGGTCAATTCACACCAGGGATCCTAAAAA
ATATATTTACAGAAAATATGTTTTTAATTTAAGAAAATATGTTACTTTATGGTCTGGCACAATTAAAAAAAATTTTTAAGAATTCTGTGCGTTCTTTCTC
GAGATTTATTGTCCTTGTTGGACAGCCACCAGAATTTCGCTGGCTCTGGGACCGATGCCCTCAAACTACTAAAGTGCAGGCTTGCGCCCGTTTTTAAAAG
GCTCCCTCACTTTGAAACTGACGACCTGTCAATGTAGAGCTTAATACCTTCCCAACACTCGAGGAGCAAGTTCTCCCCGAAGCCATAAATTTGGTAACAC
GATCACGTTCTGATGCAGATATTTATTTTCCACAGTCGCAGCACAAGTTATTTATTTACAGATTTCCGATCTACCATACAGGTATCTATTTTCATTAGAC
GAAGAAATCCATATAAATTATATTATGAGGTACCCTAATTCACATGAACGCTAATGTGAGTATTGGTGAAAGATATCAATGCCACGTGGTGATACAACCC
TGGGTAACGGAAATCCCAGCCTGTGCATATACATGTATATCCCTATTTTCTAAAGATTTGCAGTCTTAATAAACAACTCGAGTTCAATAAGGGCGATCTG
TGAATAAGTTTGGGGGCTCTGTGATTCCGAATTCGCAACATGTAGCCAAAGCTATTAAGCTGCAGGATTTCATGGGCGCCTGGGGTTAAGTTGGAGGACA
G