Description :
From Genome Similarity Track
Location :
Scaffold_222:407643- 411343
Transcript NameFunction/comments
Aphin_H310_13578phospholipidtransporting ATPase putative

Sequence
3700 bases(100 bases per row)
GAGGCCGCGGCAACGACCCCGAAGAACGAGTTCCGCAACCTGTACATGAACCCGCGCGGGAGCGAGGTCCACGGCCCGTTTTGCTCGAACATTGTCATCA
CGTCCAAGTACACTGTCTGGTCGTTCTTGCCCAAGTTCACCGTCGAGAGTTTTGCCAAGCTCGCGAACGCGTACTTTCTCGTCGTGTCGGCGTTGCAATG
CATTCCCGCGATCACCAACACGGGCGGGTGCGTCCGTTCGCTTGTTGTATCCATGTATTTCTCATTCAAACGTCACATAGCATTCCGTCGTCGCTTCCCG
TGCTGCTCTTCATCCTAGCGGTGGACGGGACGCTCGCCATCATAGAAGATCGTCGTCGCCACTTGGCTGATGAAGAAGCAAACTCGGCAAAATGCCATGT
CGTGAACCGCTCGACGGGGGCGTTGGACACGATCCTGTGGTCGTCGCTCGAGGTCGGTCAGATCGTCAAGCTGGACAACCGCGGCACCGCCCCGGCGGAT
CTATTGATCTTGGCCGTTCACGAAGTCGACGCCGACCACAAGGCTGGCATTTGCTACGTTGAAACCAAGTCGCTGGATGGTGAAACAAACTTGAAGCTTC
GGTGCGGCCACACTCCTTGTCCATGCATCGTTCGTGATCTTTCACAATCGATTCGACAATCGTGACGCCTCGAACCAAAACTAAATGTTGGCTATGTCGA
TGCCTAGCCAAGCCATGGAAAGCACGTTGGATGCCCAGACCGAAGCCGAGGTCCTCGCGTTGCACGGCCGCGTCGAGTGCGAAGTCCCGAACAAAGCGAT
CAGTCGCTTTGCAGGTTCGTTCTTTGTCGATCTACTGGACGGGTCGGTCGCGAACGACCCGATATCGATCAAAAACATCCTGCTGCGCGGGTGCCAACTA
CGCAACACCGAATGGATGTACGGCCTCGTGCTCAACACGGGCCCCGATACGAAGATCATGCAGTCGTCGGCAAAGCCTGTTGCCAAGTGGAGTTCGATCA
ACGGACAAGTCAATCGCATGATTCAGTGGCTTCTACTGTTGCTCGTGCTGCTCTGTGCGGCGTCTGCCACGGCCTTTGTCATCTGGGTATGTTCCCGCGC
GTCAAGTTGGTTGGTTGGCATGCTTTTTCACCATATTGGTGTCGTGGAAATTTGGATTTTCGGGGGCGAATTCGAGTGTTCATTTAATTGCATGGCACAC
AACCCGATGATGGGCTTACAAAGAACGCCCGCGGTTCTGACCACGTGTCCTGACTCGCTCCTTGTAGGATGACACGTACAACGCGTACCCGTGTGCAACG
ACAGAGCCGCCGACGTGCTACATGACGCTGGAAACCAACAGCGCGGCCTACCGCTGGTGTGTGGTGCTCCTAGAATAGACATCACGGACTCATCTGGATT
CGGCAGGTTTGTTGGGTTTGGCCAGTACTTTCTCCTCATGTACCAAATCATTCCCGTGTCGCTGTACGTGACGATTTCGACCGTCATGTTTTTGCAAGCG
ATCTTCATGGCGATGGACTTGGACATGTATTTTGAAGACCTCGATGCCCGCATGATTGTGCGTTCCATGGGGCTCAACGAAGAGCTCGGCCAGATTTCCT
ACGTTTTCTCCGACAAGACAGGCACGCTTACGTGCAACGTGATGGAGTTCCGCAAGTGCTCGATCAACGGCGTCAGCTACGGCCTCGGCACGACTGAAAT
CGGTAGAATGGTTGCATGATATCGTCCGAGTCTCACGGTCGTCTTATTTGAAGGTCGCGCTGCGCTCAAACGCAAGGGATTGCCTGTCCCGGAACTGCCC
CAGGCGAAGAAAGGAGTCAAAGTCCCTTATGTAAACTTTGACGACCCGAAATTACACCAAAAACTCGCCGACATTCCTGCGCACAGCAGTGCTCACTGGC
CGAGAGAAGCTGATTTTTTCCTCCACTTGGCCATTTGCCACACGGTGATCCCAGAGCAAGCGACGGACAAGAACGGCGAGTCTGTCCTCCGGTACTCGGC
ATCGTCCCCGGATGAACAAGCGCTCGTGTCGGCGGCCAAGTTCTTTGGGTTCGCCTTCGAGTCGCGCGGGCTGGGCGTGGCGCGCATCCGCATCACGAAC
AAGGCGCTGCAGCATGACCCGAACGCGCCGAGCGAGCTGTGGGAATTCAAGGTGCTGGACGTGCTCGAGTTCAACTCGGACCGGAAGCGCATGAGTTGCG
TGGTCCAGGACCCGAGTGGCAACTACATCCTGCTGACCAAGGGCGCGGACAACGTGATCACGCCGTTGCTGTCGTCGACGTTGAACGACTCGGACGTGGT
CGCGACGACATTTGAGCAGCTCCAGTCGTTTGCTGACGACGGTCTGCGCACGCTTACGATTGCCAAGAAGACGATTCCGACGGCGTACTACCACCAGTGG
ACAAAGCGGTACAAGGCTGCTTGTGCGTCGCTGGACCAGATCGAGAAGCGCAAGAACGGCCAGGCAAACGACATTGACGCGTGCATGGTCGAGCTCGAGC
AAGACTTGGTGCTGCTTGGGGCGACCGCGATCGAAGACAAGCTGCAGGACAACGTGCCGCGCGCGATCGCTCGGTTGATGGAGGCCGGGATGAAGGTGTG
GGTGCTCACGGGGGACAAGCAGGAGACGGCCATCAACATTGCGTACGCGTGCCAGCTCATGGACAACGACATGATGCAGTACATTTTCAACTTGGACGAG
TACCCCGACTTGACTGCGCTGCGTGAGAGCCTCGACTTGTGCGTGGCCGACCTGAGCCGTACGTGTCTTGCTGGCGTGGCTGAGAGTTGACGAGATGTTG
TCCGCAGACGTGGAAATCACGCGCCGGTCGCTTGTGATTGACGGCGACGCGTTGGAAATGGTGATGGCGGACGCAGACACGTGTGCCATGTTCTTGAAGG
TCGCGATGGCGTGCGACTCTGTCGTGTGCTGCCGCGTGTCGCCATCACAAAAGGCCGATGTCGTGGGCCTGGTTCGCACCAACAACCGCAAAGCTCGGTG
GGGACACGACGCGCCTCTCTGGGGTTTTGAATGCTCAAACCTGACCTCTAGAACGCTGGCGATTGGGGACGGTGCGAACGACGTGGCCATGATCCAACGG
GCACACGTCGGCGTCGGCATTTGCGGCCAAGAAGGCATGCAAGCCGTCAACTCGAGCGACTATGCGATCGCGCAGTTTTACTTTTTGGAAAAGCTGTTGC
TCCACCACGGCCGGTTGAACTACGTGCGCATGTCCAAGCTGGTTGGGTACATGTTTTACAAGAACATCATGATGGCGCTGGCGCAGTACTTTTACTTGTA
CACGACTGGTATGTGCCTCGTCCTCGCCAGCAGAGCGTGACCGTCATGGCTGTAGGTTCGTCGGGGCAAAAAGCGTACTCTGAAATTGCGTTCCAAGCGT
ACAACTTGGCCTTCACGTCCATGCCGATTGTAGCGTTGGGCGTGTTTGATTTTGATGTGCCATGGGCCGTCGGCCAGCGGTTCCCCGCTCTGTACAAACC
TGGCATCACGGGCGCATTGTTCAACACGACCGTGTTCTTCAAGTGGATTGCAGCGGCGATCTTTGAGTCCGCCGTGATCTTCATTGCGACTGTGTACGCG
TACAACCAACTGGAACAAGGAGTTGGCAATGGCGACTTGCAGCAGTATGGGATCCTGCTCTTTACCCTGGTCGTGTTTGTGTGCAACTTCAAGGTATGCA