Description :
From Genome Similarity Track
Location :
Scaffold_193:40762- 44591
Sequence
3829 bases(100 bases per row)
TCCCTCTGACGCTAAAGCTACGGCAGCCCCGCAGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGGA
ACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTAATAAGCTTATGTCCTTGCTTTGGGCCCGGAGGGCGTGGCTCATCTTGCATCGC
AAGGTCCCAGAGGCGGTCACTGCCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCAAGAGAAGATGAGCGCCCGCAACGGCGG
CGGCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGAC
CCGTGAGGTCGAGATGGCCATGGGATCGGCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTGTCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGG
CACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGAGATCAGCTTAAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACC
GTATCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCT
CTTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTTGAAGAGG
CGGTGGATGTGGCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAACCTCTTCGAGCGGTCCAGAGCCGATGGA
CCTCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGG
GTCTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTAC
TGGGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGTAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAG
CCGGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTGCAAAGCCATAAAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCAC
CCTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAG
GTCTCTGTCGACCTTGGAGTGAAGTGTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGATATGACCTCATCCTTGGCATGG
CATGGCTGGAACGTCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCGCCCTGCTCCTAGTGGAGCTTTGGTGAGTCATTAACCCAC
CTCTGCTAGGAAGCAGAAGCGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCT
GTTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCGGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAG
TGGCGCGTAATCCACTGAGTGGTATGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGG
CCCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCG
AGGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAACAAGAT
GCAGGGCGTCTGTGACGTCTTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAA
CGGAGTGACGGGAAAGGTAGAAGGCGATATCAGCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTCGGC
GAAGCCTTAAAGGCAGGCGAGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACA
CCAAGAAGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGAAGACGTTGTCTCAAA
AGACCCACCGACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCG
AGAGAGCAGTGTGACGTCATTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTAAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTG
TCAGAAAGCCGAACGGCAAGTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCT
GCAGAACAACATGGTAGGCTGTACACTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCG
GTGAGTACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTA
GGCCCCACCGGGCGTACGCTCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTT
GCGAGCGGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATT
GGGAAGCGTGGCTTACGGGCACATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAG
CCAATTACTTGCACAAGTACAGTGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTTAAGAAGGACGCACCATGGTGCTGGAACGTCGAGCA
CGACGGAGCCTTTGAGGCTGTGAAGGAGAGCCTTCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCC
GATTTTGCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAACGCGTGATCGCGTTTGAGTCTCGCCAGCTCAAAGCTGCAGAGAAGAACT
ATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATCTTTACTGATCA
TGCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGCGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAA
GCCGGGGCGGCTTAATGTAGTGGCCGATG