Description :
From Genome Similarity Track
Location :
contig_3:407602- 409339
Transcript NameFunction/comments
g1005.t1RAW40639.1 hypothetical protein PC110_g3170 [Phytophthora cactorum

Sequence
1737 bases(100 bases per row)
GTTCCTTGCGCACGCGTTGAAGCCACGTGGCAGCCTTTTGGTACGAGTGGTTAAGTCCGTAGGCTTCCTCAAAGCAAGACGCAGCTAGCTCCAACTGCTT
CTTACTGTAATGACAAAGCCCCATGTTGTGACTTGTAACGTGGTGCTTGCCCATTTCTTGCGAGGAGAGGGTGTAGAACGCGAGTGCGCTGTCGTACTCG
TGCAAACCGTAATAAAGGCGACCGATTTCAAACGCCACATCCTTCTCCTTGTCTAGAGCGTAGTAATTCTTCCAGACCAACGGGATTCCGTACATCACAT
CCTGCTTCAGTTTGGCAGCAGCAGTCGGTGACTGGTCCAGCAACACATCTCGGAATTTGTAAAACACGTCCGGATCCCACCCGCTTAGCTTCATCAGCGC
TAAGACGGCCTTGAGCGACGGCGCTTTTGCATCCTCCTTTGTGGATTTTTGCATCACAAAAAAGTCGTTGGGTCCAAATGATACGATTTCATCCTCAAAA
GCCGTCGAAAGGTTGGGGAACTGTACGCTGCGTTTCTCGCATGTCTTATCCAGTCTGTCGCCGTACAGTTCCGTCATTGTCGAGCTGGCTGCTTCACATT
CACCAACAGCGTTGGCCGGTAGTACGAACGCGGACACCTTAAGGCTGGCCTCTTCCTGAGGGCTATGTAACGCGAATCCACCTCGGCTAGCAAAGTAGAC
GCCAATAGCGTGATAATTAACCATGACGGAGAAGCTACCATGCACGGCGATGTGCGGGTCGCTAACTCCCCGGAAGTGGTCTGGGTTGTTGTTTCCCTTA
TCACCTGACAGCGCGACGAGACCATTCTTGGACAGCGCCGCAAGGCGCTCGATGGCCGTCAGAGCACCGATGGGCACGAGAATCGTGGCGCCCGAAGACG
CCGGATCAAAGTATTCATGGTACCATTTCAGGATGTTGTTGCAGTGAGGTTTTGCCTCTCCGTAGTACGTTTCGTCAATCTGCTCGTACTTGAAGTTATT
GCTCAAGCGCTTGATGATCTCGGGGTCTAGTGGGTCAGGCTCCTCCGCACGCTTCGAGCCAACACTCACAAGACCCTCCTTCAAAACACCCTCGGAAACC
TGGAACAGGTCGTGGTACAGCGTGTCGAATAGGTAATTTGCAATGAGACACAACGGATTGGCCAAGTCGCCCGGGCGGATGACCTGACCCGATGAATACA
GACGCAACTCCGTGTCGGTGGTGGCGTCAAAGATGGCAAAGTCCACAATTCCGCGCTTGACGAACGGAGCGAGCGCTGGGTGCGTCTTCCAGAAGTTGAA
GTTCTGCTCCGTGAAGTCCGTCATGATGTAGCGGATGTTGCTGAGCGGGAAGTCCAACACGCTCTGCACAGGCCAGAAACAAATAACCGTTAGCGTCTCT
GTTGCTGCATTCGAGGCCGGTAGCATCCGAAGCTCACCTCCATTTGCGCGAGTGCCTTCAACAAGTAGAAGCTGAACTTGCCCGAGCCGGCGCCAAGCTC
CACAATGTAAAACGGCTGCGAAGGATCAACGGGTGAGCCCGAGCGCGGCTTCATCGCGTCTCGGAAATACGCACGCAGCACGTTGCTATAGCGCTTGGCA
ATGAACGTGTTGGACGTGATGAAGTGCGGCACGATGCCCTGCGCCCAGGACTCGACGCCCTGGCGGTCGTAGAAGGACATCATGAGTTTCCAGAGGTGGC
AGCGCGCGAAGGGTGTGAAATCCTCCAGCTGACAGCG