Description :
From Genome Similarity Track
Location :
contig_3:407589- 409326
Transcript NameFunction/comments
g928.t1RAW40639.1 hypothetical protein PC110_g3170 [Phytophthora cactorum

Sequence
1737 bases(100 bases per row)
GTTCCTTGCGCACGCGTTGAAGCCACGTGGCAGCCTTTTGGTACGAGTGGTTAAGTCCGTAGGCTTCCTCGAAGCAAGACGCAGCTAGCTCCAACTGCTT
CTTACTGTAATGACAAAGCCCCATGTTGTGACTTGTAACGTGGTGCTTGCCCATTTCTTGCGAGGAGAGGGTGTAGAACGCGAGTGCGCTGTCGTACTCG
TGCAAACCGTAATAAAGGCGACCGATTTCAAACGCCACATCCTTCTCCTTGTCTAGAGCGTAGTAATTCTTCCAGACCAACGGGATTCCGTACATCACAT
CCTGCTTCAGTTTGGCAGCAGCAGTCGGTGACTGGTCCAGCAACACATCTCGGAATTTGTAAAACACGTCCGGATCCCACCCGCTTAGCTTCATCAGCGC
TAAGACGGCCTTGAGCGACGGCGCTTTTGCATCCTCCTTTGTGGATTTTTGCATCACAAAAAAGTCGTTGGGTCCAAATGATACGATTTCATCCTCAAAA
GCCGTCGAAAGGTTGGGGAACTGTAGGCTGCGTTTCTCGCATGTCTTATCCAGTCTGTCGCCGTACAGTTCCGTCATTGTCGAGCTGGCTGCTTCACATT
CACCAACAGCGTTGGCCGGTAGTACGAACGCGGACACCTTAAGGCTGGCCTCTTCCTGAGGGCTATGTAACGCGAATCCACCTCGGCTAGCAAAGTAGAC
GCCAATAGCGTGATAATTAACCATGACGGAGAAGCTACCATGCACGGCGATGTGCGGGTCGCTAACTCCCCGGAAGTGGTCTGGGTTGTTGTTTCCCTTA
TCACCTGACAGCGCGACGAGACCATTCTTGGACAGCGCCGCAAGGCGCTCGATGGCCGTCAGAGCACCGATGGGCACGAGAATCGTGGCGCCCGAAGACG
CCGGATCAAAGTATTCATGGTACCATTTCAGGATGTTGTTGCAGTGAGGTTTTGCCTCTCCGTAGTACGTTTCGTCAATCTGCTCGTACTTGAAGTTATT
GCTCAAGCGCTTGATGATCTCGGGGTCTAGTGGGTCAGGCTCCTCCGCACGCTTCGAGCCAACACTCACAAGACCCTCCTTCAAAACACCCTCGGAAACC
TGGAACAGGTCGTGGTACAGCGTGTCGAATAGGTAATTTGCAATGAGACACAACGGATTGGCCAAGTCGCCCGGGCGGATGACCCGACCCGACGAATACA
AACGCAACTCCGTGTCGGTGGTGGCGTCAAAGATGGCAAAGTCCACAATTCCGCGCTTGACGAACGGAGCGAGCGCTGGGTGCGTCTTCCAGAAGTTGAA
GTTCTGCTCCGTGAAGTCCGTCATGATGTAGCGGATGTTGCTGAGCGGGAAGTCCAACACGCTCTGCACAGGCCAGAAACAAATAACCGTTAGCGTCTCT
GTTGCTGCATTCGAGGCCGGTAGCATCCGAAGCTCACCTCCATTTGCGCGAGTGCCTTCAACAAGTAGAAGCTGAACTTGCCCGAGCCGGCGCCAAGCTC
CACAATGTAAAACGGCTGCGAAGGATCAACGGGTGAGCCCGAGCGCGGCTTCATCGCGTCTCGGAAATACGCACGCAGCACGTTGCTATAGCGCTTGGCA
ATGAACGTGTTGGACGTGATGAAGTGCGGCACGATGCCCTGCGCCCAGGACTCGACGCCCTGGCGGTCGTAGAAGGACATCATGAGTTTCCAGAGGTGGC
AGCGCGCGAAGGGTGTGAAATCCTCCAGCTGACAGCG