Description :
From Genome Similarity Track
Location :
Scaffold_3:407585- 408854
Transcript NameFunction/comments
Aphas_H257_01723histidine kinase

Sequence
1269 bases(100 bases per row)
CAATTGGGCGTTGATCTTGGCTTCCATGCGTGCAAAGTCGCACGTGAGCTTTTCGATTTGCTCGGCGTGGACTCCGAGGGTCTGAGACATGGAGATCTGC
TGGGTCGCCAGCTGCTGCTGTGTCAGCGTCGTTTGACTGAGCAGGTTCATGAGCAGGTTTTCCAGGTTGTTGCTGGAGCTGACCATGTCGGTAGCGTCTT
GGTTGTCGGCCACCACCAGTTGGTGGTGGTGGTTCTGACTTGTCGGATGCTTTTGACTCGAGTGACTCGTCACGGCCGTGCGCAGGCTGTCGGTGCTGAT
GCTGCTACCGCGCGTGCTTCGCGTGGCGTCGCTGCTACTCCGCCGAGCAGCGTACTTCTCAACCCGATCTTCCTTGAGCACCAAGTGCTCCATCGCAACA
TTCGCCAGCTTTTCCAGCACCGACGCATCGCACGCGTCCCGCGGTGCTGTGTCCAGGACTAGCACGGTGCCGACCACAAGGCCCGTCCGGGCGTCGCAGA
TCGGCGCCGACGCATAAAACCGGACGCACGCCGCGCCGGTGACGAGGGGGTTGTGGCAGAATCTGACGTCGGCGGCGGTGTCCATCACCACGAGCGGCTC
CTTGGACACGATGGCGTGCGCACAGAACGCCACGTTGCGCGGGATGGACGTCTGGGCGAGCCCGACGCTGGCCTTGAACCACTGGCGGTCGGCGTCTATG
AAACTCACGGCGGCCATGGGGCAGTTGAGTCGCTTGCTGACGAGGTCGCAGATGTTGTCGAACACGGACGACGGCGGTGTGTCGAGGATGCGCAGGCTGG
CGAGGGCGCGGAGCCGATCCGGTTCGTTCGCGGCGATCGGCGCGCGGGGCCACGGGTTGTCCCAGTTGTAGTCGAGCTCGTAGTCTAGCTGGTTGGTCGC
GGAGTAGTCGTAGTACTCGGTCTCGGACCGTGCGGCGGGGGACGTGAGGTGGTTCGACAGCCAGTTACGCGATGCTTCGTCCGAGACCATGGTAACGTTT
GTGGCGGACGCCAACGGAGATCCGAGTTTCTGAGCGCCGCTGACCATGACGATGCACGAGAGGCAGACGCGGACTTTGGTTGTACCGATGGACAAGATGT
TCACGTTTTTGTACAAGGTGCAGTTGCGGCATACAACTTCGCCGCACATGCGGCAGTGGTGCTTTCGGCGAAATGTGCTAAAGTTGCGAGTGCATACGTG
ACACAACGATCGCTCGTAGTCGCAGACCCAATCGTCTGCGTGAACCAACTGGTCGACAACGAGGACGTC