Description :
From Genome Similarity Track
Location :
Scaffold_194:4075- 12110
Transcript NameFunction/comments
Hyaar_Emoy2812328reverse transcriptase
Hyaar_Emoy2812329PREDICTED: uncharacterized protein LOC101496047
Hyaar_Emoy2812330hypothetical protein

Sequence
8035 bases(100 bases per row)
GGATTCCGCTGAGCCTTGGTGTAGTCAGTATCGGTCTTCTATCGGAGACCATCCCGGGTCGTCGATCTCACGTTTGCCTGGTAATTTCTTTCATGCGTGA
TAGCTAGGTTTCGGTTTGCATAGCTTCATAATTCAATATAATTCCCCTCGATCTTTCATCGTATTCTTCTTCTGTAAATTAACTTCATCTCTTGGGCATT
TTAGCCGCGATCAAACTTTTACGATCCGCTGTCACCACACACTTCACATATAACCCCAATTCCACCATCCCATACAACCTCCTTGAACATATTCCCATCC
ACTATCTCATATGACCTCCCATCCATCATCTCATCTAACCTCCTTGTTCATATTTTCATCCACCATCTCATACAACCTCCTAGTACATAGGCCCATCCAC
CATCTCGTACACACCTCCTTGTATACGTCAACCGCTTGTCGCTTCGATTATTCGTTAACCTTCAGCTTCCTCTCCGTAAGATTGCATCACCTCGAACCAG
TTTTGACTTACACGATTGCGCTTGAAATCCTGCAGCAACGCGCCACAGTTCAGATCTGCTTCGTCGATCCAGGTCGGATCGCTATGTAGCTTCCACTACA
CCAAATATTGTCTATGTACTCGGCCATAACGGGTCTTACGTCCCGATCGCACGTCCAAAATTTGCTCCACTTCGTATTCATCAGTAGCCAGCTCGTTCTC
CCAACTGTCTTCCGGAAGCAGCGACTCATCGAAAATCACGCGATCCCTACAGTTGACCACTAACGTATCGCCTGGGCGATCGCGGATCTGTACCACTTGT
TTTAACTAGGAAACGTGCACTACTGGAAACAGTTGGTTTGGAGTTCCTGCGATCTCCAAACGGACTGCATGCTCTTCACACAATTCAGTCACTCGAAATG
GTCCATGGCACACATGTGCTAATTTGCGATCATAGCCGTCTTTGACCCGATCTAAACAAAGCCAAACTTGCATCCCACACTCTATGTTACACGATCCCTA
ATTGACATTATGCTGATACGCTCGATCTCGGATTGCGATCTTGAGACGTTCGTTTACCGTCGCTCTTGCTTTTTGATATTGACGCTGGATGTTATATCTC
CATCTTTGAGGGTCAACATCGCGCGTGTTTTAGTGCTCGCTAGCAGTAGGGTTGCTTTCAACGTCGGTTGTCGATCCCAGCCATGGATCAAATAGAACGA
GGTGTCTCCACGGACATGATATTACGCCGTGTTCATGGCGAATGTCAGTCCTTCCGCATATTCATCCCAATCCTTCAGATCCACGTCCGTGACGTACATC
TTGATCTCTCGAGTCAACGTCTGCATCATGCGTTCCGCAATCCTGTTCGCTTGTGGTTGATAGGCCATGGTTGCGCACTGCTTTTGCCCTGCGATCCAGT
TAAACGCTCTATAAAAATCTGACATAAATCCAGGCTCCCGGTCGTGACGTATAGCTTTACTTGCTTTAAATCTTCGAAATACCCATTCATCATAGCCTTC
AGCGATCGCTTGTGCGGTCTTCGAAGAACTTGCACTCGCAATCAAGTAACCCGAGAAGGGATCTACGCACACAAGTAGTTCGGTGTTTCCTTTAAATGAC
CGTGTCAGAGATGGGATGTAATCCATTGCGATTACCTGAAATAGGTATGTAGCCTGTATATTCCCAGGGGATCTGCCACTGATCGCGAGTAACCCATTAC
AGTCGAGCAGTCCATACGTTCGCTAAAATAACGCTGGATACCCCGATATAGACCTCTCCAAAGGAAATTATACCTGATCGCTGATGTGTCTTCCCGATCC
CTTGGTCATCACCTTCCAAACTCGTATGGTATGGTGCATACAGTCCTGTTGTAACAATTCTAATAAATATTAGACGGACCATCTCCATGCGATTGTCCGA
CTGTTCAGAGGATCAGGGGCAGAAAAAAGAGCAATCCACTTCGTCGTCTGGAGCGATCCGAGCGCATAATTTTACATTTTCGGCGTTCAACTGGGTTAAG
TCGCCTATAGGATATTCCTTCAGGTTGGCGATCCAGATTTCTTCTTCTTGTGCCTGCTTTTACGCTCGATCCGCATCTGCTGCACTATTTCTTCTGGCAG
AATTTCGGGTCGTCGAAGCCTTCGCTGCGCGGATCGTGTGATCGCTGCCATCTTCCCTACGCGGTCCATCATTTTTGGCATAAACAATTCGCCCAGCCGG
TTAAGTGATGTCAAATCTTGTAAAACTTGATCCGATGTTACGATGGTACCCTTCTCCTGCTGCAAGGATGCACTCTCTAGTCGATCTGCGCTCTGGTTCC
ACTCTCGCTTTATATGTAAGAACTCGTACTTCGGACATGATCGAAGTTTCTGTATCGCTTTGTGAAGCAGCAGCAGCTTTATATCGGGCCCTTTACAGTC
CACTTTATCCCGCATCTGCCGGATCACTGGGTTTGAGTCACCACATATAACGACGCTCCCTAGTTTGGCCATCCAGCAAATCGAAACTCAGTAACAGACC
ACGATGTTCACCCGCATTCACCGTTAAATCCGCTTCACATTCCGAAGCAGCCGCTATAATCGTCCATTCTGGTAGTTTCCATACGATCGCGATATACGAC
CCACTCTTCCGTTTCGTTTGGGCCGATCCGTCGAAGCTAACCACCAGTAGTCTCTTATCTGTTTATACTGTGGGGGGGGGGCTGTGTGGCATGATTACAA
TATGTCTAGGTTGCTTTTTTGGATCGATAGCGATCAACATCTCATCTACATCTTCTCAAGGAGTTATGCTAGCCGCGAGTGTGCCGAGTAATTCATCTTC
CCCATTTCACATCTCCTAACCTCTAGTGTCCAGTTCGATAGCAGCGCGGCCCATCTTCCTAGTCTCCCGTTGAGGCCGGGGGATTGAACTAGCCAGTTTA
ATGTCGAATATCGAGTGAGCACCTTGATCTCCCGGGATACTAGCATAGTATAGCACATGTTCAAAATTCGAAGCAAGGCTAGCACCTCTTTCTCCACCAT
TCCATAATTAATCTTATTGGGCTTCAGTGTACGGCTCGTGAATGTCACCGGCCAGTATACGCCATCATATTCATGTAGCAGGGATGCCGACACTACCCAA
TTGCTAGCATATATCACGATCACTGGAAGTCGATATCAGTCGTAGTGCTTGGGAATCGAGGTAGTAGCAATCTTGGCCTTCAACAGAGCGAATGCGATAG
TGAACTTTTCCCACCGAGATCGTTCATTCAGATCAAGATCACCTCCTTATAGGGTGCGATCGCGAACTCTTGCCATCGCATCACGATCATTCATATGATT
TATCTCTAAATAGTCTGCATCTCGTAGATCGCACAACACAGATGTGTGTACTGCAAAATCTATAATAAAGCGACTGTAGTAGTTTAGACTACCCAGGAAC
GATTGCATGGAGCGCAACGTTGTGGGGAAGGGGATGTTAACCAGCGATTATAGATCTTTAGGATTAGCTTCCGACCCGGTTAATCATACCTGGTGACACA
GGTAATCCACCTTACGCCGCCAAAAAAAACTCTTGGTCAAGTTGATCGACAAATTCCATCGATCGCATACCGTCAGTAGTCGCTCTAACTTGTTATAAAG
GGAAGTCCACGACGTAGATAAGATCAATATATCATCAGTATAAGATCGTCTACCCAGCACTGACGGCGTCTGGTCGGTTTATGGTTCTCCTTCAGTGAAC
ACATTGGTCAACCTAGAGGAATCTGTTCCGGTCGCATCCTTGCCCGCGCCGATCTTGAGATATACATAGAAATCGTTATCAATCAAACGCTGGTAAATCT
GTGGAGCGTTCTTCAGTCCAAAAGGCATCCTTAACCATTCAAACAGACCCGACGGTGTGGAAACGCAGAGATTAACTTTGCTCGTTCGGTCATCTCCACC
ACCCAAAATCCACTAGCCATGTCCAATATACAATACCACATTGCCTTGTTTATATCTTGAAACAATATGCTGATAAGCGTAATGGATAAATCATCAATGT
GTTAGCTGATTCACTCGTCGATAGTCTATACATAGTCGGATGTATTCTCCATTATTTTTAATAATCACGACCATTGGTGACGCCCACGGCGATGTCGAAG
GTCGAATAATCTTAGCTGACAACAGTCCTTTTATCAGATCAGTCAACTTCTCACGAGATTTAGGCGCAATCAGTCGCCCGCGCTGCGCGATCGACCTTGC
TTCTCCAACATCAATATCACACACGGCCCCACGTGCTGCATGGGGTAACCCGTTTCCTTTCCCAATCAACAGGTGACGACTCTTCCATATCACTTGTCGA
AAATCCTCTTGATCTTTTGATAAGGGTACCCCAGCATCGCCGACCTGGACAACGTCGATCGTTATCTCTGTCCCAGATGTCGTTACCTCTGGTAGCACAG
CCATATGCTGCTCCAAATCTTTCTCGAACAGTTCGCCTCCTTCGTGGTAACATATTGATGCAGCCGGTACATCTTCTTTCATCATTCCTCGTCGATCGCA
GCAGCCTCTGCTCTGTCGACCAATCGTGTGGACCGGCCATGGACTTCCCGATCTTCGACCATGATCTCATCTTGCTGATAGTTGGACTGTACTTGTAGCG
GATCAGTTGTCAAATGGTCGACCTCCTGTGCTATATCTCTCTTTGTCTACCCCGTCTACTTCGCTCGATCGTTCTAGGGTCTTCCGCACTGCGTTGGCCG
CACACGATCCCTTTGTCGATATAACGTCCTTGACTTCGTTGATCTCCCCAACCGTATACTCGTCTTGAATCTCACCGTCAGTGTTACAATCAGGTTCGGA
TCGCGTTGCGATCCCAGTAGAAACCTTTATGGTTTCTGATTCCTTATCTGGTCGAGTAGAAATTCGGGTGGGTTTCTCGTACGTAGGGCGATCTACTAGT
GGTCCCGCATATGCTTCAAGCTCTTCTTCTTCTCGAACTGTAGTAGCTTCAAAGGCCAGTGTTTGCCATTCCTTATACCGCCGCGATCCGTCAGAAACAT
ATCCCTGCAATCGCGGTATCATGTCCGCTGTCATCCAAAATGCTAGTGGAGCTCCGTAATTTACGTTCAAGTCGCGATCGCCTATATTCGTAAGCTCGAG
AAACTTGATCTGTCCGGGCTTATTCGTCACTGTTCGTACCGACGCCACATCTCGCCTCACCCAAATTTTGGACTTGGGGGATTGACACCGATCCTGGCTT
CGGTTGATCTACCGGCAGGGATGACAATATGTTGATCGTTAAGGTTGATCGCCGGTATATTTGATCGGTATGGCGGTCTCCGCCCAGCAAAAACGCGAAC
TTCGTCCGGTGGACACAGGGTTCCGTTGGCTAAATCGAAATGAATGCCTGCTGCAACCATGAAGTCCATACCTAGTATGGCTTCTTGACCAACTTGATCC
CCAACCCAGACATCAAGATAGTATACTAGCGATCCGCCCAATGTGATTTTGACCTTGGTCCGCCCCACTGTCATATAAGCACTCTCCCCGATCCCAAGAC
ATTCTTGCGTTCGGCTCTCGTCAATCACACATCCTACTTTACGAGCAAAGGTTGTGTCGATGATCAAGATTTCCGCACCAGAGTCAAACAGCAGAGTGGC
TTTTCGCATTGTTAAACTTGCCCACTGCTTTCGCTTGTTTGAACCATTTTTCTGAGGTACGATACTTCCAGTATCCCTTTGACTCCCCTCGGGAGAGATC
GAGCTTCATCTTCACCGGTATTCGGGCATAATCGTCCACTCTTTTCACACTTGATATTGAGGAAACAAATGTAGAACGATCACATATATTATTGATCGGA
TCGCGTCTATCTTTAACTCCTTGATCCTCCAGTATTTTCAACAAATGCATATATGCATAGCCTAGAACGCTCGGATTGTGCCAGATTCCAACCTGGCGAG
CCTTCTAGTATAACATCTCCTCGATCTTTGGAGGAAACATCCCAGCATGTTTGGTAGGCACGTACCACTTGCGGATCAAGTTGTAGAATTCTTCAATGGG
GCACTTGCCATTCCCATGCATCTCCCCACAAGCTTCACACACATAGAAACACTTGTCCGACGGGTGTCCCTTGCGACCGCACTTCTGGCACGTCAGTCTC
TGCCATCATCCACGATCGTTGTGTCTCTTCGATCCGCAATGAGTGCAGGCTTTCTGAAACGCGACGCGGTACGGACTATATTCTTGACGATTCTCGTCGG
TTGTAGCACGTTGATCTCCTAATTTTGTCCGGCGATCCGAGGTCGCGGCCACAAATACATTACGTAGTTCCCGTTCTGCGTCCTATACGCTAAGGATGGA
GACCGAAGAACTGTCCGCATCCTCCACGTGAATGGGCCTCATGGCACGCACTGGTTTAGCCGGTGTTGGAGAAGCCGTGGGTGCGGGTCGTGGTCGAAAT
TATTCGATCGCATGAGTGATTGATTTTTTCGACCTTCCATGCGCTGGTAAGCGAGTAGGGTCTCCTCCATATCATCCAAATCCCGATTTGTAACAGCGTC
AGTAGCTTGGCCAGATCGCAATCGCCCAAGGTCCCAATAAAATGTTTTACATGTTCACGACGTATGTCTGGGGATCCATCTCGAATTCGTATCTTTTTTC
TATTCGCTGCCACATTCAACCGACACAGGTAATCCAGAGGCGTCTCCTCCGGTTGCTTCTTGTCAAGGTAATATTGTCTCCAAACGGACATACCATCACC
ACCATATTCCACGAGAAAAGTTTCCTACAGGTCCTTTTTACGAATGGAGAGTGAATCGGCTCAGCTGACTGTGCCAATTTCTCGCAGGACCCGTAAGCAA
ATCTCCAAATACCAAGCATTCTCCATATCTGGAGCTTGATCGCGTAAGAATGCAGACTTGACCTTGCCAATCTAGCTCCTGGCTCGATCTTCGGCTTTGT
CCTTTCTATTAAATTCTTTCAGTCCTGCGATCGCAGACATCCGAATCCGTGGGGCGCTAAGTCCACCACCTGGCACTGTCTCCGCAGTAGCAACAAGTGG
TCATCTCGACTCATCTTGCCCTGAGTTGTTGGGATCTCCTGCTCCACGATAGTGCATTTAGCGCCACAGTGATGCGATCCGACCGATTCCATTTCAATAT
CAGGGGTATAAAACTCTTGATCCCTTGCAACCTTGATCCGCTGACTCGGGTAGATTGCTTGGCAGGCCTGATTACGGTGTTCCTGCTGAAATCGTTCCAT
GTCAGCATCGAAAGATAATTGTATTGTCCTTTGGTAGTCGAACCCGTATCTTCTGTAGCGCTACGGGTGTCGATCGCGGTCCGCTCTCGATCCCTTTCCC
GCAACCATGTAGATCATCCTTCTTTTACATGCGATCGCGTAGATGAGCAGCCCCACTTTGTTTAAAGACATCCGCTGAAATGCCGATTGAGTCCCCTGAC
TCTACATTAGACTCGGCTGAGGCATACTGGAACGATTCAGTGTGATATTCTCTCTGAACTCCTGCAGCCGTCGGTACCACGTGATCGTTCACCGTAGTCG
CTTCCGCGTGATCGTTAGCTTTACGTATGCCCGTCAAAGGGACTATTTTCTCATACAGCGATTGACACACGTGTATCATGCGATCCTGTTCGCAATCCAA
CAGCTCTCTTGCGTCGAACGTTCCAGCGACGAATCCCGCTTCGTTCAGCAGCTGTATAATCCCAATGATTCCATTTAGTGTGTTCGACGCGATAACTGGG
GTTGATATAAGGCCTTGAATTGTTCCAATCATCTTGGGATTCAGTATCCGGAGCACAATATCGCTCGACAAGCACTGCTTATGCGTTCTCCAGTGATATA
TCTCTGCCATCTGGTCCAGTTGCCAGTCTTCCATCTTCTCTCATCTTCCACAAACTTGATTGGTCTGATGGCCGATCTCGTCACGCGATAGGGTTGATCC
GATCCTTGCGCTGTCTTCTTCACTCGTGCAGTCTTCGACTTCTTCATTTCTTACGTCGCATGAGTGATCTTGGATGAACTTTCTTCGGTTTTAACCCAGC
GAGTCATGCTTTGCAGCATGATCCGCGGTGTTCCC