Description :
From Genome Similarity Track
Location :
Scaffold_260:4075- 7180
Sequence
3105 bases(100 bases per row)
AAGAAGCCCGTATTGGTAGTACGGCCTAAGGCGACCGACGTAAAATCTAGGATGAGTGCGCATCTTACGTGGCAGTTCAATCGTATTTGCGTTGCCTAGG
CGGCGCAGCACACAAATTGGACCGATGAACTGGGTAGTAACTTGTTACTAACCACGTTAGTCACTATGTGTAGAGGTAGGTTTTTACCGTAGATAGTAGG
ACTAAGTCTCCTTCATTGAATAAAAAAAAACATTTGCCCTTACATTCTTGTCAGCGTTTCGTTTTTGTCGATCTACCGCCTCTGCATAGATTCTTGTACG
AAACGGACAACTGTTTCGCGAGCCAGTATGAATTCATCTGCTGACTCGCTGTCTTAAGCTACAGTGCTCTTGGAGTGTACTGTAGCAAGATCACTCGTCG
CCTCTTCGAGTGTGTCTTTGGACGCAATAGTCGTGATGCTGATTAGATCAGTATCGTGGTCAGTAAGAGCATCTTCGCTCTTACTTTCCTCTTCTTCACC
GAAGTCGATGTGATCGACATCGGCGTCGAGCGTGGTGACCGCATTGTCAGCACGTGACGAGTGAGAGCCGGATTGGCAGTCGATCGAATGAGTTCCCCTC
CCTCAAACTAGAGTCACACTCTAAAAAGGCGGGACGACGCGGATGGCGTAAGCCATTCACGAAGAACGGCGTGTGCGTCGTCGACGCATGGACTGAATTG
TTGATGGCGAACTCCACCATCGGCAATAGTTAGCTCCAATTCGTAAAAGAATGGACGTAACCTCGAAGGATCTCTTCGAGAACACGGTAGGAACGTTCTG
TCTGACCATCCGTTTCATGGTGGTCAGTTGTGGAAATCTTTAAGTGCGCTCCGAATGTTTTGAACACGGCTCTAGGACTCAGCTGCGAATCGCTGGTCCC
GATCGGAGACGAGTTCACGAGGCAGCCCATAAAGGCGGAAGATCGTTTCTATAAAGACACAACACTACTTGATGCGTTGGTTGATTCAGGTACAACTACC
AGGTGTACCATCTTGCTGAATATTTCAACGAACACAAGAATAACAGTAATATTGTGCGTATCGGCGGGGAATCTGAAGAAGAAGTCCATTATAACGGATT
CTCAGCACTCAGCCGAAACAGGCAGAGACTACAACGGGGCACGAATGGAAGGAATAGACTGACATCGTCAGATGTGTCTTCTCGTGACCACTATACCCAT
AAGCAGGTGCGTCGTGGTATTCATACGTGATTTACAACCGCTAATTACCATGATTGGGTACGATGACCGAGGCGTGTTGCCGACAACAGCTGAATATTTT
AATAAGCCGTTGCAAACTGTATATTTATCCGTGGAGGATCGATACACTGCCAAATGTTGGTTAAGGCTGTTCGGGAAGGTTGAGAGAGATGATTCAGCAA
TATAACGATGTCCGGATCATATGCCTTTCGTATTTCTTCCGGGAAGGTTGACGACGGAATACTTGAGGTCCATACCGCAACCGTGGTTATACCAGTTTCG
GGTTCCGCAGACGGTTTGAAATCGGGACGGCACGAGAGCGAATCAGCGACGATATAAAGTCGTTCTGGCTTATACTCTACAGAAAGGTCATACTCTGCGA
AAAATGAAAGAATGACAGCCACCTTGCCATTCGTTGCGATAGTTGTGGACTGTTTACGGCCGTGCGTAACGACGCATGGTCCTTCTCGACAATAAAGGTT
CTATGACTTAACAGGATGATCCTCAACTTCGCCAACGCGTACTTCATGGCAAGGAGTTCCTTGTCATAGACGTGGTAATTACGTTTAGCTGACTGCAGCT
AACACGACTGATAGCAGACGATGCGTTCCGCACCGTCTGCATCGTACTGCATTAATGCACATCCGATTGCAAAATTGCTGGCATCACATACCACACGAAA
TGGCCTGTTTTGGTCCACAATTGACAAAACTGGCTGTATCAAGATTTTCTTGATATCTTCAAAGGAGCGCTGACAGTCGGTACTCCATGCCCACTTCTCG
TACTTTTCAATAAACGAGAGAAGAACAGTCATTTCGGATTAATTGTGCAAATACACCGCTAAGCCAAAGAGCTTTCGAATCCCTTTTGCATCTGAAGGCA
TCGGCCAGAGGTTGATTTCCTTAATCATTTCCAGATCGTGCCGTACGCCAAGTTTACCCACGATGCATGCAAGAAGTAGTATTTTGCTAGCAGCAAATAT
ACACTTCCTTAGGCTGGCATACATTTTATTCTCACGCATAAGTGTAAGAACCTTCCAAACGTGTAGCCCGTGTACTTCCACATCTGTCCGTCTGTCCATA
TTCCCGGCTATGGCCAAACACATCATCGAAGTAACTGGATGCAAAATCTCGTGCAGATCTCAAAAGATTTATCACACGTCTGTTGAACAAAGCAGGATAA
TTGCTTAGAGCCCGTTTGGGGTGCTCACTGCTGCATGCGGGTGTCCTTTTTGCGCATAAGGATCTGATAATAGCCATTTACAAGATGTATTGATTAACAG
ATGGTACCCTTTGCCATACCATCTATGATATCATTGGTATAGGCGTTTGAGCAGGTACCGTTGCAGTATTAAACTTGATGAACGCATGCACTACATGCCA
TCCTCTCTGTGGCTTTTGCACGCAGAAGGTCGGAGAGCTATTTGTGGAGATCCACTTCACCACATGGAGAGCTGATAAGCGGTCCGGAAAGAATTTTTTT
ATGGATAGTACTTGTTCACGAGACAAAGGCCATTGCTCTATAACACAGTACTTCGAACCCGGTTTCAGATCTATTTCTTGATGATTACATTTTTCCTTTA
GGTATCTTGCACGGTACCGCTTCTAGGAATACATCCCTGAATTCAATCAAATCATCGTAAAGAGGAGTTTTTTGAGCGATTTCCATGATTGGGATGTATA
TCGCTCAATCCGAGTCTTCTCATCAACGACACTCTCGTCCATTAATGAGCTACTGAGAGCTATTTCATCCTCGGCAAAGACCATTCCCTATCGGATTTCG
GTGACGTACTCATCTCATGCTTGACTTTGCCACTACGCAGATCACGCAAGAATCTCTTCTGTTCCAGCGTGGGAAATTGCGTGGTCTCCGAAGTTAACTT
CGGAG