Description :
From Genome Similarity Track
Location :
Scaffold_14:4075- 5088
Sequence
1013 bases(100 bases per row)
ATCCGGAGTTTGTCCGGATACGGATTCCACGTGCTGGAGTGGCATCGGTCCTCAACGTCGTAGACCCAAGCATCCGCACGCTGCATGAGACTGCAGTGGT
CGTTGCAAGCGCTTAGCTGGTGAACCAATGTCTTGAATTGAAGCGATGAGTGACGAAAAAAGGACCAATGCCACACGAGTTTCACCGTCCAAAGTCGACA
GGACGCCTAGTTGCGACCGCCCTGCCGTGCGATACGCTGCCGTGCGACCGAGGCCCTCGAGCGCGAATTGCAGAATGAGCAGCGCTTAAGGTTTTTCCGA
TTCTCTTGTAAAAGCACTGCGTTTCGCCTTTGTCGTGCTCGTCTTTACACTTGTTTTTACACGACTGAACGGTTGCGCGGAAATGGGACCGTTTCCGAGT
GCCACGTCATAGAAATCGACTGTTTTCATACGTTGTGAATATCTCATCTCTGGTATACGAGGAAGCATATGTACCATCAGACAAGTGATACTACAAGATA
TGAACTCGTCGTGATCGCGGAAGAGAAACGCAGGACCGAGCATGGTAAGCTCTAAGCCTCTCGTTGCAATCGCTCCACAGCATGCGATGGTTTTGGACGT
ACTATTGCCATGAATATCGATACGGTGAAAGGGGCGCTCGTCGTTACTACAAGTCTAGAAGACAAGACCAAGGCGTGCCAATGCGGTCATTTGCTTCTTT
TCGTTTGTAGAGCGCTTTGTATCTTCGATCTGGCATTGCGCGCGCTGTACGACTGTAGCGGCAACGTAGCTTGGTCTGCTCTGCTCTCCAAAGCGTATTC
TATCAATGTGCCAACTATGGGCGATTCCATTTCAAACGCGATGTTGTCGACAAGTGGCGTCAACGCCTTGCCGTGGCGGCTATAAGGTGGCACTACGATC
TTAGTTTGACGGAGTAGTGCCTCTCAGATGGTACTACGATCTTAGTTTGGTATGCATTTTGGATCGCGCCTCGCTACCGCTGTACGCCTAGGACGTGTCG
ACGCGGTCTCGCT