Description :
From Genome Similarity Track
Location :
Scaffold_29:40748- 66822
Transcript NameFunction/comments
Pytir_DAOMBR486snap_masked-pir_contig_29-abinit-gene-0.49Titin
Pytir_DAOMBR486maker-pir_contig_29-fgenesh-gene-0.6Extracellular nuclease (ISS)

Sequence
26074 bases(100 bases per row)
ATCGAGCAATATTCCAGTGAGATCGCTACGATTCACCAAGTTGTGGTCGAGTGGTTCAGCAGCTCGTCCTTCACTTCGATCCTACCGGACCCGCCAGGAA
CAGCCGTGTACCGCAGCCCGCTGATGACACTTCGAGGGAACTCGACTGTTTCTTTCAGCTATCGCCTTTCGTCAGGTAAATTTGTGCTCGCGTTAACGTC
TTTTGGTGCGCAGCGTAGTTTACCAGCTTGTATGTTTGCTGTCTTTTTGTTAGCATTCTCAACTTTGAACATCGAGGTTTTGCTCAACGCCACAGAGCAA
AACGTGCTCTGGACAAGCAGCGATGCAGCATTCTTTCCAAACCAGTGGGTCAAAGTGAACCTCGCCATCCCAATCCTGTATCCAACGACATTTGAGCTCA
GCTTTCTTGGCGAGACGGATGAAAGCGATTCGATGTCGCTGAAAGGCATCGCAGTAGTCGACTCTGCTCAGCGAAACCGTGCCGGGGCGCTCCAGCTGGT
GCACGCGACTGGAGGAATGATAACCATCGGTGTCGATACTGTGCCTGGGATCCCAGATCCGGTGTTCTATCGGGTTCAGATGAAGCAAATAAATACCAGT
TTTCCGAGCGCCATCGCGTATGCAGGTACAGTATATGAAGACATCTTCGATATACTGCGTCTCGGGTAGCTTCTTTGAATGCACTGAAGCTGATACTTTT
TTTACCATGTAGGACCGGGCGTGGACTTCCACGGCTGCTATTCAGCGACTACGATGTATAAGATCTCTACCGACTCAGAAGGCGCTACACAACAAAACTC
GATTGATCCAGCTCACTGTGGCTCACTGTGCACATACCGTGAAAACCAGATTCACTTCTTGTCAACGTCAAGAGTGCAAAGTGCAAGTGAGTTTGCACTA
CCTCAAAACGGGTTCACACTTGAATTCTGGTTGTATCAAGAGAGTAAAACGTCCGATGATAAGAGCACGAGCGCGCTACCTCAGGTTTTGATGGTATACG
GAATAGCGGAGGCCAACATTCGCATCACACTCGACAGCGTCTTCACGATTTGGAAATGTAATAACTCGCTGAGGCTTCCTTACGGACTGTCCTACGACGG
ATGGACCCACGTGGCGTTCTCGTTTAAAGTAGACAGTGGAATCAGCCTTTTCGTGAACGGACAAATGGCAGCGACAGGTGTGCTGAGCAGCTCAAGTTGC
GAAATACCGATGTCAGCCATACTCCAGTTTGGGCGAGGTACGAACATTGTTGACTCTTGTACCTGTTTGTTATGATGACTGGCTGCAGGTTTGGTGGCAT
GACATTTTTGTTTGGATTGTTTACTGCTGGTAGACTCGATGGAGATATTGCAAGCAAACACAACGTCACACTTTGTGGGCAGCATGGACGAGGTATGAAA
TGCTGCTTCGCGGCTGTCTTGGCAACCGTCGCCTCGCTCACCAATGCGTGTCCCTACTTTTCAAATGACTACGATAGGTTCGAGTTTGGAGCACTGTTCG
GCGATCAAGCGACATTCTCAACTGGTACAGATCCAACTTGGTCGACCCCGCGATGCTGTTGCTACTGAGGTTCAATCAGAAGAACGCGACAGTGGCTTTA
TCGGGTGAGGATGATAGCGGGAACAGCAACGACTTCATCATTGAAGATGCAACTGCCTCTCAACATCTCCAGCCGCGCTTATTTGGCCTCGCTGGAGACA
GATCCTGCTACTGCAGCCAATTCGCAATTTCGACCAATTTCGCCCTCGACGCAAATGTCTGCGATCGACAGTGCGATGATGGGAGCGCACAAAGCTGTGG
GTCTACTCTCGACAACCAAGCAGTGAGCGTGTACACTCGCGGCACAATCCGGATCGATGGTCTAGTTCCCAGCACAGAGTACGAGCTCGCTGCATCTTTT
GTAACGACCAATGGCGATGAGTTCGATATCAGTCAAGTGCTCGTTGCAAGTACAACCGGTCCAACGATCCCGGGTTTTGTTGGCTATCTCAGCATTGTTG
AGCGCCTGGAGAAGTACGTTGAGCTCCAGTGGACGGCTGTTAAAGACGACGGAGGCGCCGATATACTCAAGTATCAAGTCTTTGTGAACGGATACCTCGA
GCTAGAGACTGCGAACGGGGACACGTATTCTGCAGTACTGGAGAACGTCGAGCTTCCCCCGGACTGCATAATCACCGTGTCCGCTGTGAATAAGCTCGGC
GCTGGACCTCAGAAACTGTTGCTGACGTCTTTACCAGCCGGCAGTGGCACCCCATCTGCTCCAAAGCTCTTGGCTCAGATCAATATCACGGGCGGTTCTG
TAACCTTTGATACAGGAGATGAAAATGCGATTTCGAACGCGACATTGTCAAATACAAGCGCGCTGGTCATCGAGCAGCGCGAGTCATCCTCCCAACGATT
CACGAGTTCTTTCACGCGGCCAACCAGCGGCAGCTTCATCACAGTGTACAAGCTTCGCCACGACACCGTGTACGTATTTCGTTCATACTTCGTCAATTCC
GCGGGTTCAGTGAGCGCATTCAGCCCTCCCGTGGTGGTTCAGACGGGAAAGCCAGGTGTGCCCGGCAAGACCCCGATGCCGATCGTAACCCAAGTGACAG
GTTTGCTATTGCTGTTGCGGTTGACGAGGGCGTATGTTGATGATGTACTAACTGGTGACAACTGCGGTCTTGATGTTTTGAATATATAGGAGGCTCGATT
TCCTTGGTGCTGACAGAACCACTCGATACCGGTTAGACCCGTTGTGGTTAAATGTTGAGGTTCAAGTAACTCCTTATTGAGCTAACTCGCTTTCTCTTTC
ATTGTAGGTGGTCTACCGATTTCGACGTACAACATCTTTGTTCGTAACGGCACGCAGTTTGTGAAGCTAACAAGCGTCGTAACAAGCTCCGATGGTGAAC
AGGCTGCTACCATCTATCGAGACATCAAGGGAGCACACCTGAGCTCATCGACGACGTACACGTTCAAAGCACTCGCTCTGCAGTTTGGAAGTGCTTGTGA
AGAGCTTTCAGCGAACGAGCAGGAGAGCGACGAATTTCCAGCGACAACCACGGCGTTGTCAATCCCGCTCCCACCATCGGCACCATCGCTGATTTTTGTC
GATGGGTGTGTAGCGTCAATCGCGATTGCTCCTCCAGAGGACCGAAATGGTGCTGTTGTGAGCGGATTCAGCATCCAAATTTCCACTGTATCGGACATTT
ACCGCACATTCATGGCTGACTACACGTTGAGTCAGATAGAGTTGAGTAGTTTGATGCCTTTCACCAATTATTCCGTGGCGGCCTCGATGGTGACGGACGT
CGGGAATACGGAGTACAGTGATCCACTATGGTTCACAACCGGTGCAGCGCAAGCTCCGTCAAAGCTGCCGGTTTTCAAAATCCTGGAAACGAGATCAAGC
TCACTCGTGTTGTTGTGGGCAGAGCCTGAATCTACTGGAGGAGGGGCATTAAAAGGTACACCATGCAGGGCGCCTTGTCTCCATTGCACTATAGTTGAAC
AAACGGTAACAGGTGCCATGTACTTGTATTTTGCTAGGTTATCGAGTCTACCAGCGTTCAATCGACCCAAATGCTGAGAACATGCTAATTTACAACGGTA
TCAACGATCCCATCAAGACAACGCTGGAGGTGAAGGATCTGGTCGCCAACTCGGGGTATATTTTCGCTGTGCTGGCGTTCAACGAGTTCAACATCTCAAG
TTTAGATACTGACAACGTCATCCATATCGCGAGTCTCAAGCCGTCTGCTCCTTCAGGCGTGGATGTTAGCACTGTCACCAGCGAATCGGGCGGCTCACTT
GAGATTACTCACATAGCGGTTACTGACACCGGCGGCTTCGCAACCGAGTTGCTTCGTTATTACGCCCGAGTGCGGTTCCTGGGTTCGTGTTACAGCTCAG
CCTCGGAGTGCACAACTTGCTCGGCGACCATTGTCGATCCTAACGCCAACAGTGTGTACCAGTTTGATACGCCGGTCGGCGGCTGCTCAGCACGGCCGTG
CGATGCCGNNNNNNNNNNNNNNNNNNNNNNNNCGAGCGGAACTTGCTGCCGTGATGCAGTTGGATACGAGTGTGGGGTTGTTGCGAGCAAGACCGTGCTG
TGTTCCAGTGATTCGGCAGCTTGCATTATCGACGGCTTGACGCACTCTACGATCTACGCGACGTCAATTACCGTTGGGAACCCGATCGGCAACGCGAGTT
TCTCAAGCGAACTCTTTGCTTCAACAAGGTAACGCTGATGATATTTACTCTTGTTGGTACTTCTTAAAGATGTGGTAGAGTTGCGTACTCACAACAAATT
TAACTTTATCAGTTCTGCTACAAATCCGGGCGCTCCAACGCTCGAGCTGGTGTCATCCCGTGGTGGAGCGCTCGAATTGAAATGGGTAATCCCAGAGGTA
TGAAGCCCAAATCTGCATGCTTGGAGTGGCAAGCGTTGTGATACTAATAGTAAAGCTCTCTTCGCAGGATACTGGCGGCGCTCGAATTGTTCGACGATCG
CTCTTCGTAGAAGGAGAGCCACTCCTTGAAACGATGGATGGCGCCAGCTTTACGCATTGTCACCTTCACATCGAGACGGAGTATACCTACCGACTCGAAA
TCGAGAACTCAATGGGGCTCGTGAACAGTACCACGCAGACATTCCGAAGCACGACCTATAGCACGCCTTCGGAGGCGCCCCAGCTGAAGCTCGACAGCGT
TCACGCGACGTCAGCGCAGATCAGCGTCACTGACGCTTGTGATAAAGGAGGCTATTCGATACTGGACTACTACTACGAGCTACGAAATGCAACGACTGAT
GCAATTGTATCTGACGGGGGATTCCTGTGCTGCGACACAGTGTTGAGCAACTTACTGCCGTCGAGCGAGTATTCTCTTCGTGTCCATGCTAGCAACGTCG
TGGGGCAAAGCAACTGGACTGCACTGAACTTCTCGACGCCCAGTGGCATTCCCTCGACTCCGTCGACCGCCCTGCTCTACGCGTCGACATGGAAGCTTGA
GCTGTCGATCTTCCCACCTGTTGTTGTCAATTCCAGCGCGCTGACAATCGAAGTGGTTGCGAAAAATGTGTCGACCTTGGATACAATCTATCAAAACTCG
CCGACGTGTGACTTTAGCAACGATCAATCCTTCATCTGCCCCGACTCAGTCGTGATTGACGGACTCGATAAGATTGCAGCCTCCTATCAAGTCTTGGTGC
GTGCAGTTGCCGATGGAGGGCCGAGCGAATGGTTTGAGCGTGTGTACGATACAGATGCAGGAGAAGCAGGGACGCTCAGCTTCAGGAAAAGCGAGTTTTC
GATCAAAGAAGGCGAGTTTTTGACCGTGGACATTGGAAAGTTGTACGGAACAACCGTGGCAGAAAACGTCACGTTCGAGATTTCCGATACCATTGCGTTC
ACAGCCAGCTGGACTTGTGAGCAAACGTCGTTTGGTGCATCCTGCTTTGCCGTAGACGGCGGAACCGGCTCAGGTAAATGAACTTACCTATAAATCAGGA
AGTTGGTATGCGATATTATTCTGACCGACTGATAAACCGTGGCTGATGCTGTCTGTAGGTCTCGTACAATTTGAAATCGGTGAGTACACAAAGACTGTGA
AGCTAGCGATCCCGAATGACGACGACTACCAAGCTTCAGCTGGCAACATCACACTGACGCTCACGTCTGCCACATCCAGTCAGTTTGCAACGCCCGCACA
GGCGAAAATCAAAGTCATCGACGACTATGACGCGGGGCGACTGTCATTCCAGGATACATCGCTATATGTAAACGAGGATGCGCAGGCTGCGCGGATTTTT
CTGATTCGGGACCGTGGCACTGCTGGGTTCGTGACTACACGTTTGGCTTCCACAGTATCGGCATTCGTTGTTGGATCCCAGTTCCAAGCTATCGCGACGT
TCGAGTCTGGTCAGACACTGACTTTTGTAGACATCCCACTGCGGTCAAGTAGCGAGTACGCATTTGGGAGCTTTGATGTGAGTCTTGCAAACGCAACTGG
AGGTGCGATTATCGTGTCAGGTACCATGACCGTCGATTTTGCAGACAAAGGTGGCGTGAGCTATCCTGGCTCTCCGAAGCTGGCGGTAAACATAGTCACA
GGAGGGACGATCCAGTTTATCTGGCAGGAGCCTGCATTTATCGGAGGTCCAAATGCCAACATCCTGCAGTACCAGATCGAACTTGAAGCTCCAAACGAAT
CGATCCAGAGCTACAACGCCTTGGGGGATAACTTCCTCCTTGTCTCGCGCCTGAAGAGTAATGGTGTCTACAAAGCGCGAATTGCAGCAGTCAACCAGCG
AGGGCGAGGTAGCTTCTCTGACAGCGTGACTGTCACCACCACAGCACCAAATCCACCAGGATCGGTCGTCGATTTCACGTCCCTCGAAGTCACGGGAGGG
TATGTTCAGCTCGGGTGGCACGCGCCGCTTGACTTCGGAGGACAAGAGATCGCGTTGTACCGAATTTCGTTTGAGGAGCCGCCCGACGCTACCATTCGCA
CCGTTGAAGTGAACAGATCGAGCCTGAATGCCTCGATTAGCGATCTGCAGGCTCTAACTTCCTACGAGTTCTCGATAGTGGCAGTGAACACTGCCAACAT
GACTGGCCCTGAAAGCTCCTTCGCGCTCGAGACATCGTTCATGGCTGCGCCAGATATACCTCCACGGCCGGTTTTGACTTTGGCCACGGGTGGAGCGCTG
CATTTCGATGTGATTGCTCCGATCGACTCTGGTGGCTCAGCGTTGACCTCGTACACAGTGTACGTAGCTCATCTTACGGGTTGGGATATCAAGTATCGTG
AATTTGCGACGCACACAATCGAGAGCAAGTCGGCGAATAGAGTGATTGGAAATGTGTCGATCTACGACCTGCTCTCTGACTCGACCTACTACGTCAAAGT
TTCGGTGCAGAGCCAATATGTAAGAAGAGGGACTTCTATCGCTGAGCTGCTTCATTCTGTTACCTTGCAAACTGACTAAGAAATGTGTGGATTTGGAAAC
AGGGGACGAGCCAACAAAGTGACTACGCTGAGTTCGACACGACCGGCCCCACACTGGTCGCAGGTATCGGGAAACCGACCGTCGCAGGTGAAGATCCCGG
CGAGATAACATTAACGTGGACCAAGCCTCTCGACTTGGGCGGAGCGCGCATCACTGGATATGTCTTGCGAGCTCGGCAGTGGTTGATGGGGAACGAGACC
TGGACCGAACCAACGGTTGTCTACGACGGTCGAAACTCGGTCGTGCTAACAGCGCGGGTTACGGGACTCGTGGCGAGCACGCGATACGGATTCAGCGTGA
CAGCGTTGAATTATCGATCCGTCTGTTTTGCCGATGAGCTCAATTCCGGTGGCGAAGAGCTCGTTGTGACAACCCAAGACGGAACAGTTCCGTTCGAGCC
AAAGAACATGCGCGCGGTCGAGGTGACGGGCGGCGCAGTTACTGTCGTATGGGACCCGCCTCTCGCTTCGGGTGGTGAGCCGGTTTTGGCGTACGTTGTG
TACGCCGGTATCGCAAACGAAGAGTTCTTTGTGATCTCGAACATTGACGCCGCTGCGCCAAGAACGCTCACAGTTTATGGCTTGCAGACATCAATACAGT
ATAAATTCACAGTGTGCGCAGAAAACACCCATGGACTGGGACGCAACACGACGATCTTGCTCGTGACTACCTCCGAGCCGACACCGCCGGGGACGCCAAA
GAATTTGCAGCAGTATACATCAACATCAGGAGGTTCGATCATCTTGTCGTGGGACGCCCCCGATGACGCTGGCGGGATCACGTTGCAGAGCTACGAAATC
TATCGAAATGGTTCGCTGCTGGTCAATCTGGATGCGATGGACGGGAGTACGGTATTCACCGACATGGACAATATCTCTGCAAGTTCGATCTACAACTACT
CGGTAATTGCAGTCAACTCGCTGGTGTTTGGCACTTCGCCAGCGACATTGGTTGTTCGTAGCCCCCCAGCCTCGCTTCCATTGCTCCCAAGTGTGAGTAT
TGTGCAGGCAAGAGGAGGCTCCGTGAGCGTCGAGTGGGTACCGTCGCCTGATTCGGGAGGTGTTCCCGTTCGGGGCTATACAGTCGTGGTCACGCGAAGC
GGCACGGCAGTGGCGTCGTACGAAGGGGTGCTAACTCGCCAAGTGTTTCGCAATTTGTTCGCCGAGACAGAGTACCAGGTTGGCGTCCAAACGAAGAACG
ATCTGGGGCTGAGTCCGGTGGGTATAGCTCTTGCAATCACTGGTTCAGCCGAACAACCTGCGCAACCGTCACCTCCAGCGCTTGTCAGTGCGTTTGGAGG
CCGAGTGCGTCTTGCGCCGATGGCCCCAGAGAATTTCGGAGGAAGCGCGATCACGTTTTACCAGTTTTTCCTGAACGACGATCCTGTGGACGCTATCTTG
ATCTCCCCAGAAGTCTACGATATCGTCGGACTCGCTGCTCTTACGGAGTACTTGCTCTCTGTGAGCGCTGTAAACGTTGTCGGAGTAGGCGAGAGGAGTG
ACTCCATCCAGATCGCTACCACTGATGTCTCACAACCTGGAGCGATCTCGATTGTGGTGGTGGAGTCAACCACTCACGAAAGCATTGAGATTTCATGGGA
GCACCCAAAAGACACTGGCGGCGCCAATGTGGCCAGCCTCGATTACGACGTCTTGGTTACAAACACTGAGGACAGCTCGTCGCGGACGATCGTCGACGTT
GTTTCTCCATTTGTAATCGGCCAACTTGATGCGAGCATGTATTATGCGATCCAAGTGCGTGCAAAGAACGAGGTCGATATGGGTGGATGGAGTATCACGG
TTGTTGAGCGGACTGACCCAGTGTCTCCCGGAACGATCAGCTTCTTGTCAAACACCATGAGCGTATCCGAAGCGAATTCTACTATAAAGATCACAGTAGT
GCGTGCAAGCGGAGGCTCCATCCCTGCCTCGTGCAATTATCGAACGATAAATGGCACTGCTCTCGACAATGTCCACTACATGGGGGTATCAGCGGGCACG
ATCCACTTTGATGCGGGAGTGAAGCAACAAAGCGTGAGCATTGCGATCATCAACAACGACATCATCGACGATCCAGACAAATTCTTCTTTGTCGAGCTCA
TGGAGATTGACTTCGAGTCGGGGGCGATCGGCGCGATTGGTAACCTTACGGTGACGATCACAGATGACGGTGATAGCGGCTTGATCCAGTTTTCCCAGGC
ATCGTATTTGGTTGTCGAGTCGACGCCGAGCATCCTGATCCCTCTTGTGCGTGTGAAAGCGTTCAGCGGCAAAGTGGACGTTCGCATCGACGCATTCGAT
GTTCTCGATGGTGCAGTGCAAAACATCGACTACTTACTGCTCAATTCGACTGTTTCGATTGCTGACCACGAAGTTGGAGCCTCGATTCGAGTGCAGATCA
TGAACGACGCCGTGTTCCAGGTTCGCAAATTCTTCGGTTTGAGCATCACGATCACATCAGGTCGGGCAGGTATTGGAGCAGTTATGCCCACATTTGTCGA
GATCCTCGACGACGGCGATGTGTCGCGACCGTGGCCACCGAAAGATGTCAAGATCGCAATCCTCTCTGGCGGCTGGGTCAGTGTCAACTGGGCTGCGCCA
GTAAACAAAGGAATGGCAAATGCAACCTTTTTCTCGTATCGAGTCGTTTTGACGTCGGATATGCTGCCATCGCAAGAGTTTACAACGTTCAACAGCTCGC
TCAACATCACCAATTTGGTGGCAAAGTCGATGATCAGCATCGCAGTCGCAGCGAAGAACAACGTTTCAGAGAGCTACCTGTCCGCACCAGCTCTAGCTCG
TCTGGGGGCTCCAACAGCACCCACAGTGCCTCAAGCAGTTCAGATTCTGTGGCGAACTGGTGGCGCCGCAAACATCACGTGGCAGCCTCCCTTCGACTCA
GGCGGCGCAGATATCTTGCTCTATCACGTCAACATGAGCATGGGCTTTGGGAGCAACTACACAATCGCTCGTTATGATACGCAGAGCACAAGATTCGCTG
TCTACGGTCTGCAATCGCTTGCCGACTATAACATCACGGTTCAGGCGCTCAACTACGAAGGGCTACTTGGCGCTATTTCGCCTATTGTAAAGCTGACAAC
TCGAGCCTCGTCTGCGCCGAGCAAACCACCTGGCGTGAACGCGACGAAGGCAACAGGCGGCGCGCTTTATCTGTCTCTGGCACCTTCGCTGGACCTGGGC
GGTCTCAATGTCACCAAGTTCACACTATCAGCTACGTCACTTCAGTTCCCAAACGTGTTTGCTGACGTGTACGAAAGCAACTGCTCAACGTACGTTCTGC
GCCGACTGGCGTACTCGACAGAGTACAAGCTCAAGTACAAGGTCACAAACGCAGCGGTAAGTTGTAATCTCTGGTCTTTTCCTTGTGCGCAGGAATTCCT
TGTGTGGAGAAACGGTTGTTGATGGATTTCTATGTTGACTGTTAACAATAGGGTGTGAGTGAGTACAGCGATGTGCTATCTGCAAAGACAACTTTCATCA
CGTTACCAGACGAACCACGCAACGCAACGATTCTTAGCACGACTGGTGGCTCGGCTACGATTTCCTGGGAACCCCCACTCGACTTTGGAGGAACCGATAT
TACGAATTACGAGATCTTGTTTTTCACTGGCTACGAAGTTAAAGCGCAGTACAAGCAGCTGGTCTCGAACGCCAGCTCCAAGGCATCTACGCTCATGGCG
AAGATCTCCGGTTTGAATGCGACTACGACGTACGGGTTCTTTGTGCTCGCGGTGAACGATATCAGCGCGTGTGTGGACACCACCGCAGTGACAAGCTACA
ACGTTGTCTATGCCACGACCTTGAACGTCTCAGCCCCCGAGGCCCCGCAAAACTTGAATGTAACCATCAGCACAGCTGGCATGCAAGCGATCACCTGGTC
GCCAACGAACGATCGGGGTGGCGACCTNNNNNNNNNNNNNNNNNGTGGTGTACGTTCTTGTTTCCGAGAAAGGCGTAGTACTATACAATGGAACACAGAC
GATCTTCAGACACGGCGCGCTGACCCCGAACACGTCATATGGGTACGCTGTCACGGCGAAGAACTCGGCCGGCACGAGTGTACTGAGCCCCGTTGTATAC
AAGATGACACAAGCTCGCATCGCAGTACCGAGTGCGCCAATCAATCTGGTGTTTGCCAATTCGACCGGCGGCTTGATCACGTTATCTTGGACTCCACCAT
ACGACTCGGGAGGCGAAGCGCTGCTGGGTTATCAAGTTTTTCGAGAAGGCAAGCTGTTACCGCTGTCGAACGGGACGCTGCACCACCTAAACACGACTTA
CGTTGACACTGATGGTCTTGTAGCCGAACAAGATTACTTGTACACTGTGCAGGCGTTCAACTCTCTCGGTGCTGGGCTTCAGAGTGAGTCTCTCCCTGCT
TATACCACCAGCGCGACTCTACCAGGAAGACCAAGAAACGTCACAGTCGTGGCGGTAGGAGGCAAGCTGCAGATAACGTGGGCTCCTCCAAGAGACACGG
GCGGCGTGCCGCTCGGTAAGTACGACGTGCTGATCCTTAAGGATGGCGCGATCCTCTTCGAAATGATGACGAATGCCACATCTTACGACTACTATGGAAT
CAGCGCACACATCAACTACACTGTCATCCTCGCAGCGACCAGCAAAGTGGGAATCAGTCCAGAGGTGGTGCGATCCGTCGTCAACGGCAACGCGACTCGA
CCGCAAGCACCTTTGCCACCAGAGATCGTCAGCTTCAGTGCACAGAGCGTTGTGCTCGCGCTCAAAGGTCCTCATGATGATGGCGGCGCCAACATTACAT
TGCTACGTCTGTACCAAGATGGTGTACTTGTGCGATCCGTGCAGACGAGCGGGTACGTTCAGATTGTCGTCGGACCGCTCTATGCAAACGAAGTGTATTC
GTTCACGACTACTGCCATATCACTCCCTGGACTTGGCGAAAGTCCCCACAGCGCTGTGGTGCAAGCGACCACAGACAGCCCGACGCCTCCATCGGCAGCG
TACAACCTCGCGGTCGTTCGACGAACATTTGATTCACTGACACTTTCGTGGGATGGTCCAGATGACATTGGCGGCGAGAGTCCGATCTACCTGGTCGAGT
ACTACCCGCAGCTTAACGCCACTGCTGTTGGTACCCGAGTAACGACAGTGCGCTCGATCACTATGGATGGACTCGCGTCGTCAACGTCGTACGTGGCGCG
CGTGAAAGCGAGCAACAGCGCTGGCGCCAGTGCATGGACAGCTGCGGTTGAGGGAGACACTGATGTTGCACAGCGTGGTGCTATCGTCTTCCGTCCCAAC
GTAACGACAGTGTTTGAGAACGTCACGTCAGTGACCATCGAGCTGGTCCGCGTCAACGGGACGTCGAGTAGCATCACATGCTACTACGATATCGATGCCG
ACAGCACAGCAAACGCTGGCGAAGACTACTTGCTTCCAGACCTTGCACAGCGCGAATTCGCGTTCGCTGACGGTGAGACACTCAAACAGTTCACGATCCA
GATCATCAACGATCTTGTGTACGAGCCTCTTCCGCGTGAGCTCGCGCTCGTGCTGCAAGACACGACCCCAGACCGATCTGACACGGTGTCGCCTTCGACT
GTGTCAATTTTTATCCAAGATGATGGCGACGCTGGCTGGATCGACTTTGAGGGATCAAACCTAACAGCGCTGGAAGATACAGGAACGCTCAATATTCCGC
TGCGGAGACTGAGAGGCAGCAGCTCAGCAACGAGTGTAGCCGTATCAGTTTACGACAAATTGTCGAGCACAGCAGCGACATCTGATGACTTCACGATAGC
CACGCCGATCGTGACGTTCGCGGACGGCGAGACCAGCCAATTTGCCAGCGTTCGAGTGTGGAACAATAACGTGTACGATTACCCGCTCAAATACTTCATT
CTCTCTGTGAGCAACGTAACTGGGGGCAGTCAGCTCGGTCCAAATACGCTTATTTGGGTCACGATCCTAGATGATGGCGATCTATCACCGCCTGGACTGA
TCCGCAACCCAGCGGCGATTGATGGAACAGGCGGTCTGATCAAGCTCACGTGGACGGCTCCGGTGAACGTCGGAGGGCAAGCGCTCTGGGTCACTGGGTA
CAACCTCACGATCAGCTCGGACGAGAAGACGGAGTTCATTCTCTCCAAGGACAACAGCACAGAGTACGCATTTGGCAACTTGCAGGTGCTCACCGTATAC
AGTTTCAGGATCGCAGCGCTGAACGTCATCGGAACGGGCAACTTCAGCGCTGCAGTCTCAGGATCCACCACGAACTACACGCTTCCAGGAGTTGTTGACG
CGATCTCGCTGGTGAATGCGACTGGAGGCTTGCTGACAATCCGAGTGGCAGTACCAAAGGACACTGGCGGCGCTCTGATTGAAAAGTACTTTGTGTACCT
TGCGACTCCGGACGACGCGGAATTCAAGGTAAGAGGTTCGAAACAATCGGCTTAGCCGATGTTTGGCTGATGTGTGGTGCTTATCTTTATCGTTGGTTGA
TTTTTGGTGTCTACTTGTTGCTAGCTCACGAACGAAAATGCGTCGGACAACTCGACCATCATCCACGTAAGCGTCAGCTACCCAGAGACCCAGTATTTCG
TCAAAGCAGTGGTTCGTGTAGCTGCAGTTGTTCCCCTGCCCCTGGATCCGTATCTTGAGGTGAATCGTTAAGCTGTTATGAGGACTCATATCTCTGGTAT
TTGGTGTTGATATTTGAGTGCAGGCTGTCAACTTGGTCGGAATAGGCAATCTATCGAAAGCATTCAACGTCTCTAGCGACGCTCTTTCACGTCCAGGTCC
ACCGCGCATCCTACCAAAGGCGCACTCATCGACCGGCGGCTCCATCGTTCTTGACTTGGAGCTTCCTATCGACACAGGTACGTTAGCGATCTGCCGTGCT
GCTTTGCAAGATCTGAGTCGTATCTCATCTTATCAGTGCTCGTGGGGTCGATACATAAAATAGGCGGTCACCAGAGGCTCAACTACACTTTCTACTACCG
CGTACACAATCGCGACGAGCGGTTCCAGCAGGCGTACTTCTACGAAATAGAGAATCAGGTCGTGATGTACAGCCTCGCGGCGAGCACTAACTACGACTTT
GTGGGCGTTTCTCTGCTGGATGGTGACCTCGATCCGGTCACGACCGGCGCGATCGCTGCTGACAACTCCAACCTAACTGTGGCGGCAGACGTGACACAAC
TGTTGGGTCCGAACGACTTTTTCGACTTTGGAGTGAGTCAAGTAGCTTGATTTTTATGGAAAGTTATCCACCGTGAACTGTACTGACGGAATTGCTCCGT
GTTGATGCAATTTGCTTGGTAGGCTTTCCTGTTCCAAGTCGACCCACTGGAGGCCTCTACCTCTGAGTTTGTGTTTTTCAAGAAAGACATGAACCCTCTC
AGCGGTATCATGAGTACAACGACGCTGGATCCCGAAGCCGAGTACGACCTACAAATCCGCGGACCATGTGGCAACGTGGTCAACTTTACTACGCAGCCCC
CGACGCGACCAGGAGTCCCGCCGATACCGGTGCTTTCGTACGCGACCGGAGGCGCGCTCAACATCCGAGTCTTTTCGCCGAATGACACAGGTACGACACG
CTGAATGCAAATTTGGCTGAGATGGCTGAAAGTCCACTAACCGGAGTTGTCTCGTGTCGCGCTAATGTTTTGCCTAGGCGGGATATCACTGAACGATTTC
GGTCTCTACCTGAATGAGCGCAAGGTTCGTGTATCGCAACCTCCATCCATCCATCCATGTTTTCAGTTTCTAACTATGAAGCTTGTGACGTCCATTGATG
TGCGTACCTCTATAGGTTATTGGAAACTTCTACGACTACATGTCGTTCAGCACGTTTCAGCTCGAGGTGACTGTGGAGCTAGGTGGCTTAGCTCCGAACA
CAAACTACCGTTTTGTGTATGTCCCGATGAACGATGTCTCTGGGTGCTTCGTTGAGAGCCCTCGTCTAAACGAGTCCACGATCTTCAGCACTACCGAGTC
GACACTCCCAGTTGCGATTGAGGATCTCTACCAGTCTGGCGCAACGGGCGGTGGCATCCGCGTCGAGTGGAATATCCCCGTTGATGTCGGCAGCGACAGC
GACATTTTCTACCAAGTGTACATGAGCTCGCGTCTAAAAAGCCCAGTGTGGGAACTCGTGTACAACAACACGGCGACGTACTTTTGGAAAACCAAGCTCG
AAAATGAAACGCCGTACCTGTTCATGGTCTCGTGCATGAACAAAGTCGGGTACTCGGACAACTCGTCGACCGCCATGCTCAACACTACGTTTATCTCTGT
CCCGGGTCCAGCAGGGGCATTCACGCAAGTGTCAGCCACGGGTGGGATGATCCATTTATCGTGGGCAACTCCAGAAGACAATGGTGGCAACGAAGTCACG
TACTTTGTCGTAAATGGCAACGACCAAGATGTGCGCGTGAGCGTTCCTGAGATCTACTTTGGAGGGTTGGTCGCGAACAAAGAGTACACGTTCACCGTGT
ATGCAGGTAATGCGCTCGGTCTCGGCACGGATGGGACGTTCAAGACGTTCAAGACAGGCGGTGTGTCGCCTCCTTCAGTGCCACCATCGATCCAAGTTGT
CAAAGTGTCTGGTGGGTCGGCGACTCTTGCAATTGCGGTGCCGAAAGACACGGGCGGCGTGACTGCTTCAGGTCTTTCCTTTGAGGTCTACGCGGACGAC
GTTCTCATACCGTCCTCTTCAGTTCATCTCTTGGATGCCGCAACAATTCTTCCAGATCCTGTCCCTTCGGATAGCAGTCGGCGGCTGGAAGCGCTGGGCC
AATGCCAGCCAACTCAAATAGGAGCTGAATCAGAGCCAAGGAGCCGTCGGCGGCTTCAGCAAAGTGGCCAATCGTTGATGTACTTGCAGGTCGGTAGTTT
GCTGCCTATCACGTCGTACATGTTCAAGATGAAAATCGGCAACACAGCTGGCAGCAGCGGTTTCACTGGAACCGCATCAGGCAATACTGCCGAAGTCGGA
CCCCCAGCACAGCCTGCGCCACCAATCGCGGACATTATNNNNNNNNNNNNNNNNNNNNNNGGTGGTTCAATGTCTCTGAGCTGGACTGACCCCGCGGATA
CTGGCGGCATGCCGCTGACATCGTTTACTCTGATTGTGACGGCCTTCGGAAGCGAAGTTGGTCATTGCGAAGGGCTCGTGCACGTGTGCGACGTCGGGGA
CCTCCAGTCGCTCACCGAGTACACAGTCGTTCTAACCGCGTACAATGTTGTAGGCGTGTCGAAGCCGAGCGAACCGACGATTTACACCACGAGCTTGCCA
ACAATGGCGCAGGCGCCACAGAATCCTCGCGTTGTACTGACGACAAACACGAGTGTGGCCGTAGAGTGGTTGCCATGCGAGGACTTTGGTGGCAACTACA
TTGAGAGCTACTACGTTGAGGTGAGCCTAGCATCATCGTCATCTTCCTCGTCATCATCATCGTCGTCGTCATCGGCGTTGTCAAGCGCCATGTCCGTGAC
AGTGCCGATCACGTCTCTCAACGCGACCGTACCAGACCTCGAATCGAATACGAACTACTACGCTACGATCGTAAGCTGCTGCTCTTGCCTATGAATGCTG
TGCTGGTTTCTCGCGCTTAACTGGAGTGACTACTAACTGAGGACGTTTCTTGTAGGCTGCGAAAGGGAGCGATGGTGATTTAGGAAAGCCCAGCAAGCGC
GTGTACTTCATGACCCCGCAGTACTTTGGCCAGCCGCAGCCGCCTCTGATTGGATGTGGTACGTGTCCATTATTCGTATGCACGTAACCTTCCTGCTTCG
AGATCCGTATCCTCACCCGAAGCACTCTTGCTTCTACGTATCGTCCGTCAATTCTGTTTTTGCAGTCTCACAGTCCGTCGTGTCGATTTACTGGGCTGAA
ATGGAAGGCGTTCTAAAGTACTTTTTATATCGCGACGGCGCGCACCTCGTGTACTCTGGGCCAGACACGCTCGCAGAAGACAGTGATAGTATCACAGCTG
GCAGCACGTACTCGTACCAAATTCGGGTTCAAAACTCGGACGGCAGTCTGACGATCGCAAGCGAGCCGACGACATACCTCGCTGCAGCAGCTCCTTCTTC
AGTGGTCGACGAGTTCCAGTGCGGCGGACTGAAAGGGTACATTCGCCTCAAGGACTATACGAATCAGCAAGCGCGTCAGTGGCGGATCACGCCCTTTGTC
CCCACTGGCATCACACTGAACGTAAGTACTCTTCTGCTTCAAAAGGTGGCAATATCACGGTATAATGACTCGTCCACTGATCTTTGGATGGCTCTATGCA
GGTAACATCGTTCTGGTTGGAGTGCGATTTCGACCAAATCCAGATCAACGTCACTGCAAGTGGGGTGACCGCGCCGTTGTGGAGCGGCGGGTGTCGTCGC
GATGGAGATTTTCTGATCTCCACAAAGAGCGATGTGGAATCGCTGGTCGTCGCGTTCACCTCGGACGCGAGCGTCACACACTCTGGGGTTACCATCGTCT
ACGAGCTCGAGGCTAGTGAGGCAGCCGTTGGGAGCCAAACCGTCCCCTGCCCAGGTCCAGCGGTCTGTTCAAATAACGGAGCGTGCTTCAACGGCGTCTG
CTCGTGTCTGAGCGGATACGTTGGTGAGGACTGCAGCAACCAAGTCGTTTGCCCACATGACCTGACGACGTGCGGGGGTGCAACAGGGTGCGACCCGATT
TGCTTGGAGCAGCAGAGCAGTGTCATCGCTGTGAGTATGTACGGAAACGACGCGCAAGGCACTGGCGAGATGATGGACACGTCGCAGTCCGGGACCGCTT
CAAAGGCAGTCCAGACGCTTCAGCGTGCCGTCGCCATGGCTACCACGGGTCAAACGGTTCTAATATACCAAGGGACATACCAAGGCTCGCTGAACTGCAA
CTTGGTCGTGAACAAGAAGCTAACGATTCGGGGACTCCGTGGCGCGGCTGTGACTACAATCGACTGTGGCAACGCGTTCCACGGGATCACAGTCACTGGA
GCGAATAGCGTCACGTTGGTGGGTTTTACGCTTCGTAATACGTTTGGTACCGATGGCGCAGCGATCAAAGTGGTTTCTTCGACCAGCGTCACGCTCGTGG
GTGTGCATATCTTTGGAGGGACTGCTGTTTTGAATGGCGGCGCTATTTACGCGTCGCAATCGGGTCTCACACTACAGGACACTGTGGTAGCAAACTGTTC
GGCTAAGCTAGGAGGTGGAGGGGGTCTGTTTGTCGACACTACGACGCTGACGATCCAAAACTCCCAGGTACGCGGATGCCAAGCCACAAACGGTGCAGGG
CTGTACATACTCGGCAACTCTGACATCACTGGTATCGGCTCTGCGGTCATCGAGAAGAACCACGCAAGCAATCGCGGTGGTGGGGTCTTCTTCTTCGTTG
GGACAGCCTCTGCCGAACTGTTGCTGGTGCAAGGCAACAGCGCCAAGTTCGGCGGCGGCGTGGCGTTTGAGTCTGGCTCCTTTACGATCGCTGCTCTAGA
GGTGAAAACTAACACTGCGACGAGCGATGGTGGCGGGCTCGCAGTTCTACACGACACAGTACTAGCATCAGTTGGGTCGACGATCCATACCAATCGCGCT
TCACAGAACGGCGGAGGCGTGCTCGTTACCTCAAACAAGACCCTGGCGTTTGATTCCCAGTCGCTGGTGTTGGGGAACACAGCAGGTACGTTCCTCGTAT
GTTGTTACTTCTGCTTGCTTCAGCATCTCATCTCTAGCACTATGCATGCGTTGCTATTTGTGCTCTTGTAGTCCTTGGCGGGGGCTTGTATGGCGAATGG
ACGAGTGCCAGCATCAGCGGAATGATCGTGGCGAATTGTGCTGCAACAAGTGGTGGCGGATGCGTCGCATTCACAGCAAGCTCAAGCAAACTGACAGGTG
CGGATCTAAGCGGCTGCTCGGCTCCAATCGGAGGCGGCATGTACATTACGTCCAGTAGCGCTGTGGAGCTGATGGACACGTCAATCGCATCGAATACGGG
CTTGAACGGCGCTGGCGTATACATGAACGGCAGCTCACTTGCTGGAACAAGAGCGACTGTGTCAAAGAATACTGCAGATATCTCAGGTGGTGGCGTTTTC
ATTGCTGGCATGAAAAACAGTCTCAGTGGAGTCACAATTCAAGAGTGTGCTGCACCAGAAGGTGGAGGGCTACTAGTTTCCAAAGCCTCACAGATCTCCG
TGTCCAATGTTGAAATCACGAAGAATGGCGCTACAAGAAACGGGGGAGGCATCTACACAAACGAATCCGCGCTCACGGTCACAAGCGTTCAAGCGACAAA
CAACACGGCTGTGAAACGCGGAGGAGGGCTATACGCGTTCAGTTCGACAGTGCTAGGATCGCTGACACTCGCTTACAATGAAGCAGCGCTAGGAGGCGGT
GCCGTATCGTCTGGAACGACCGTTTTCGAGAAAACTGTGATCGATTCGGATGGCGCACAGGTCGGTGGTGGCGGCGTTTTCGCTGATGACGGCGAGCTCA
CACTCCGTGATGTTGATGTAAGGTCCTGTTTCTCGGCCAATGGTATCGGAGGCGGAATGTACCTAGCAACTACCCACGTACTTCACGACCAAGTTCAAAT
TTCAACCTGCTCTGCAACCTTGGGAGGTGGATTGTATCTGGAATCGTCGTCGTTCACCCCAACCCTGTCACAATCTCCGATAGTGACGATACTATCGGCA
ACATTGACGTTGAATGAAGCCTCGAGTCTTGGTGGTGGTGTTTACGTCACAGGAGGAGACTCTAAACTTGACGGAATCAGTGTCGTTGCTGGTCTTGCTA
TCAGTGGTGGCGGTATTGCGTCAGAGAACGCGCAGGGCTGCGTCATCATAAATTGCGAGGTCCGAAACTCGACAGCTATAAGCGATGGTGGTGGCGCATA
CTTTGGTGTGAATGCAGTGTGTCTGATCGCCAACTCTTTGATCGAGCTGAACAATGCGAGCCGCGCAGGCGGAGGCATTGCAGTACACCAAGGCTCGTTG
AATCACTCGAGCCTTGTGATTCAGCACAATCAAGCAACGAACGGAGGCGGGCTGTACTTGAGTAGCGCTGCCAGCGCTACCCTTGTGCAGTTAGGCGATA
CCGCTTTTCAGCGATCATTTCTGGACGCGAACGCAGTCATCAGTGATTCAAACACTGGCGCGAATGTGCTTATCAAGTGCGATTTGGAGTGCAGCCTTTC
GGGGTTCCGCATCACGCGAGGCGAGGTTCTCAATGGCAGAGGTGGTGGGATCTTCATTTCTGGAAAGGGGACGATCACGCTCGCTGACGTAACAGCTGAT
GGCAACCACGCGCAGAGTGGCGGCGGTGTGTACATCAACGGAGCCAGTAGCACGATCATCCAGTCCTGCGGTTTCTTTGACAATGTTGCAGAGAGCGGTG
CAGGGATGAGTGTCGAGAACGTGAGTCTCTCGCTCGCAAATGTCGACGTGAGTGACAGCGTGTTCTACAACAACACTGCGCGTGACGCAGGTGGTGGCGC
GATCTACCTCGACGCGTCCACTCTCTATGCGACTTCGATCCTCATGCTGGAGAATCGAGCGACGAACAATGATTCCGGCACAGGTGGGGGTGTGTATGCC
CACAAGCGGTCGTACTTCTGGATGGAGAAGAGCTTGTTTTTGCTCAACAAGGCGCTCTTTGGCGGCTCCATCGGTGTGGACTCTGAATCCGAGGCAGTTG
TGGACACTTCGACCATCACTGGCGACCCCGAGTTGTTTAGCGCTCACTGGGCGACTTTATTCAAGCGCAGCATTGGTGCAGAGTACAACGCAAAACTAGC
GAGTCAGGACTTCCGTTTGGAATCGCGACGCGGCGACCTCGTGTTTATCAGCGATGAGAACTCGAAAATGGACATCACCGAGTCGTTCTTGACCAGTGGA
AGCGCCGAGTCAGGCGGTGGCGCATCCGTGGAAAGTAGCGCGATCTTGACAGCGACCAACTCGGAGTTTTCGAAGAATAATGCGACCGAGTCGGGCGGAA
GCGTGTTTCTGTCGGGGAACAATGCGACAGCCTACTTCAACCTGTCCAAGATCAGCTTGAGCTGTATGTATTTGTTTGCTACTTGACCATCCTCCTTGAG
GTTTTCCTGTGTTGCTAACATACCTGACGGTTGTATCTTGATCAGCGTCCAACAACTACGGCGGCGGGGTCTTTGCACAGGATTCGTCGCAGGTGTTTCT
CGCGAGTTCGTCGTTGCTCGACAACACTGCAGACGATTCCGGCGGCGCGATCTATCTCGACACGGGCGAGTTTGTCAGAGTGACGCTCGACACAGCGCTC
ATCATGGGCAACCTCGCCAAGGGCCAAGGGTGTGGAGTGTATATCGGTCGCGACGCGTTCCTAATAGGTGTGGGCTCGCTGTTCCTGTCAAATGGCGGTA
TTTCATCGACGGGGAAAACCGAGGGCGGTGGGGGCGTCACCACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNATATCGACCTCACAGGGTGCAGCTTCGT
CAACAACACCGCGGTGGTCGGTGGTGGTCTCTTCGCGGATCGAAACAGTATCGTTGCGCTTGCGTCGACTGAGTTCTTTGGCAACACCGCGGACCAAACG
GGTGGCGCGATCGCGGTCGCAGTCACAGCCACTGTAGACATCACAGCTGAGTCGACCTTCCAGTACAACGAAGCCGAGCGTGGCGGCGCGATTTCGCTCG
TGGATGGTGGCAATCTCACACTCACAAGCACGACATTTTCCAACAACTTTGCGTCGCTCAGTGGTGGAGCGATCTACGCGACTCAGCGTGCGAACCTGAG
CGTTGAGTTCTCCGCGTTTGGCCACAACTACGCAACCTACGGTGGCGCTGTGTACATCAAGAGTGCGCGTGCGTCCTCGATCTCCAACTCCGACTTTTTC
GAGAACGAGGCAGCCGCTCGCGGCGGCGCGTTCTTTTACGAGTCGACGAGCAATGTCATCACTGCCTCTGTCACGTGCGAACACAACTTGGCGCCGAGTG
GCGGCTGCATATTCTGGGTCACGTACGAAGAGTACGTGGAGCCGGTGTATCCGTGCGAGTATTGCACCATGGCCAACAACTCGCTCTACGATATCGCGAC
GAACACTCGTGACGTACAAGTGCTGTGGTGGCCGAGCACAGTGTACAGTGGTGTTGCCGCCCTGGAGCCTCCAGATGAGGAGTCATTCAAGCCCATGAAC
GCGCTGAACAAGAGCAAAGCGCAGTCGATGCTCGTATGGCCGCGTTTGAAAGCGCTCGACCTCTACTCCCAAATCGAAGCGCTGGATACAGAGACCGAGT
GCATCGTCACACCCGTTATCGATGCAAACGGCGACCGTGTGGACTTTAAACCGCACGACTACACGGTCGCTATCGCAGGTATCATCTCGTACGAAGATGC
GACGTTCCACACGGAGCCAAAGAGCGCGAGCTACCAGCTGCAGATGACGTGCATGCTGCCGAAGAACGAGAAAGAGATCGATTTCTACCAGGGCGTGAAC
GTGTTGCCCTGTGAGCCAGGGTACTCGACTGACAACGAGTACGTGCTATGCACTATGGCGACCATTACTGTGTGGAGGAGGAATGTGAGTGCTAACTCTG
CTTTGCTTTGCTGTTGTTGTTCTATAGCAACAAGTGTTCACGCTGCCCGAGGAACAAATACAGGTACCAAGAACTTCAAAGTCGCTCCCTTGCTTCTCTC
CAGCTCTCTGATTGACCTTCAAACGTTGTCGTTTCTTCTTTTTGTGTGCTGTTTAGTATGGATGGACAGCGCTGCTACAACTGTCCAACTGGCGCGCAGT
GCAACATGACGGTACGTCGCGCGACCGAGAGGCTCGGTACCGAGTACGGCACGACATCGCCTCGCACGTCGGAAGGTTTCTACTTGTTCACTGCACCGCA
GTCCAAGCAGACCCGCAACTGTGATTCGTCGCAGTGGAAGAGCGACGATCCGTGCAAACAATACGCAGAGCCCGGTGCGAACGTCAGCGACATTCTTCAC
GCCTGCGTCACGTCGAGCGAGTTCACCAAGTACTGGTCTGCTGACCGGATATTTTCCTGCGTCGCCGACAAGGCCTTCTATGTTTGCGAGGTAAGATATT
CTAGCAATGCTTAGATTGATAGATATGGAGCTAGCTGACCCCCAAAATTGTATGATGATCATGTGCGCGGTGGTAGGTCGCTGGAGCGTGTCAGTCGGAC
ATCACAGTCGAGCTTCAGTCCTCCCAGCCAGCGAACAGCTCCTGTGCCAAAGGGTACGACCAAGCGATTTGCTCGGTCTGCGCCGAGCGATACAAGAAAG
CAAAAGACAACTCTTGTCTCCGTAAGTAGCGCTCATTATGCGGCAGACTGTATTGCGATTGGTCGAAGTCAAGAGCTGGTGGACTGACTTGAAATGCTCG
TTATCTCTGATTAGCTTGTGACAAGGCAAACGCGCAAGTGCGAGCGTCAATCCGGTGGCAGAATTTTGTGATCCCGATCTTGATCGTCCTTGCGATCGTC
GTTGCGATCGTCAGCATCCGATACTACCTTCGAGACCTCACAGAGATCGCACTTCTCGAGAAAGCGGAAGCTGACCGCCGGCTCAAGCCGCAAGCCCCCG
AAAGAAAGCGACAGAGCGTCATCCAAGTGGCGAGGGAGCGCTACCGCCGGCAGTCGGTCGTGGTACTCTCGCGCTTCGAGCAGTTCAAAAACCGCTTCAA
GCACAAGCCCAAGAAGAACGCCAAGATTTTGTTTGGCATCGAGGCCGAGCCACCGTCGCGTCCGTTTCCAATCAAACCTGGGAAGTTTAAGATCTTCGTT
GGCTTTTTCCAGATTTTTGGTAACTTTCGTGACTCGTTCGTGATCAAATGGTCGCCCGACATCCAGCGCATCATGAACGTCTCGCAGCAGTTCAACTTGG
TAAAGTGCTTGTTTATTGACGCCCTGTCCATACGAAGTGGACACGTAACTGCTCGAATACTCACCAACCAGCAAATTCTTGTTCGCATTTCTCTGTAGGA
CCTGGTGTCGATCGCTGGTATCGACTGCGTAATCTCGACCACTTTCTACTTTGACTTCACGTGAGCATCTCCATTCTTGATAGTATCCCCATAATTTCTC
TTCAACTGGCTAACGTTGTGTACGGGTATGTGTGTATGTGTCTTCCACGCGACAACAACAACAACCATAACAAACAGCGTAACTGTGATCCTCGTTGCAT
TGACGCTCTCTGTGATCTCGACGTACTTTTACGCGGGCATGCGCAGCTACAGCGCCAAGCTGCTCCTGATCCCTCGCAATTGCCTCAAATGCGGACTGCC
CGTGCTGGAGGGCGAGAAAGTGCGCAACGACGAAGCGAGCATGAATCCGATCCTCTTGGCGAAGATGTGGTGGAGAAGTCGCCAGGAGCTACGCCGCACA
GGAGCAGACTCGGGAGCTGCAGTAGCCGACCAGAATCGACACGCAAGTGCAACGACGATCAGGGCTGAAACCAGGCGCCTGAAGCGCGAGTTCGGTATGT
CCCAAGTGAAGACTCCGAAGCTCGGGCTCTTCCGGTCCGTACATGTACAGTGCCCCACAAAGCACGTCCTGAGTGGCAAGATCCTTGAACGCACGATCCG
AAGCAATTTGCGCGTGTGGCAAGCGCGTGTGAAGCTGCGCATGAACTACCTCACGTACCGTAACAAGTGCTTTAAACTGTACTGCTGGGTTGCACTTTTT
CTCTACCCGACCGTGTCGAAAACGATTTTGATGATCTTCAACTGCCAGGAGGTGGGAAATGTGCGCTACCTGGTCGTGGATCGGCGCATTGTCTGCTACA
ACCCAACGTGGGCCGTGTTTGGCGTTATCGCGATGGCGGGCGTGGTCGTGTGGGTGGTCGGCATCCCGTTCTTCTTCTGGATCTTGATCCGATTAGCACA
GGACCGCGGTGTCGCGGAGCGATTGCGGCTGCTTCGCAAGCCCCAGTGCCGACGTTTACGCAAGAAATGGCTCAAGGAAGTGCTCGAGCAACACGCGAAG
GACAGTGTGTGCGTGCTCGACATGGAAAACGTCGATGTCCAGGACGAAGAGCTCGAGAAGTACATGAAGCGGAAGAACCTGACGGTAACTTTGTCTCTTT
GTGGCTGTTGTAGCGAGCTCGCTATGAAGTGAAGTTGACCATGTTGCTGCTTATATTTCGAAATGGGTTTCATGGACAGGATTCGACGGTGGAAGCGCGC
TTGGGGTTCATTTATGCAGACTGTACGTGCTCCAGCCTGCTATCTACCGCTGAGGTTTGGTGGCGAACGTGGCTGAGCTGACTCTGTTTCCTATTGTTGT
CGTATGAGCAGACTCGCAGGCGTACTGGTGGTTTGAAGTCGTCGATCTCTCTCGAAAGCTCTTTCTAAGCGGCGTGATCGTATTTGTGCAGAACGGGAGC
GTCGACCAAGTGCTCCTGGCGATCACCGTCTGGTATGTTCAACTGAGAACCTGGCGATTGTGTTTGGTTGCCGAAGTCCTCGCCTCAGTCATCTCTACCA
CTTATGTTAACTTGTTTGTCGTATGCACGTCCCCTGTAGTTTGGTCACGATGTGGTTCCTCCTGTACTTCCAGCCGTACGGCGATTACTCGGATAACCTG
ATCGCGAGCGTGACGCAGCTGCAGCTTTTCCTGACGCTCTGGCTTGGCGTGATGATCCGCCTGAACGACCTGAACGAGGAGTCGCTCATCAACAAGAGCC
TGCTCAGTCTGCTGCTCGTTGGCACGTGCATCGCAGTGACGACCTTCGGCATCGGCATGATCCTTCGCGATGGCATCTTGGAGTCGCGGCGACTGTTCTT
GGAAGACAAGGCGGACCGCAAGGCGCGCATCAAGCTCGAGGTGCAGAAGCGCTGGCGCAAGGCGTTCAACTACACGTGCTATGAGTCACAGAAACAGATG
TACGGCCAGCTGAGCTTCTCATACTTCAGCGTGCCGTCGATGCTCGAAGCCTTCCGGCGCATCAAGCTCGAGTGCAAAGAGCAGAACCTGCAGGACATTT
GCGAATTTCTTCGCCAGCAAGAAGAGCAAGGCATTGGGCTAGCGGCCATTGGCGCGCGCCTCCCGGAGCTTGTG