Description :
From Genome Similarity Track
Location :
Scaffold_482:4074- 6212
Sequence
2138 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAAAAAAAAGATCGCTTACA
GCGCAGTGATATGAAAAACTGCCCCAGTGAACAATACTATCAGCCGCGTCGCGATTCGATACTGGATTGACGGTTAACGAGGCAAAATATTACGGGTTGA
TGCTGAGTTACGAACTGCTAGCGAAACAGAAAAGAGTTTAAGTTTTCATCTGTGGTGATTCCAACCTGGTCATCAGGAAGATGTGGGACGAGATTGATTT
CAAGGCACCAGGGAATAATTGTTGCATTACAAGGCCTTAGATAAACTCAAGTCGTGGCCTACACATGAGTTCTTACACGTTAAGCGCGATTGGAATCAAA
GTACAGATCGATTGGCTAACACCACTATACAGCCTAGCAAGGCATGATTACGCTAACTGAGCAGGATCTCCTGGATCTGTGCACCATCAATCAATTACCC
CACATACTGACTCTAGTATGTAGTGATAAGGTGAAGAAGATGGCGTCGATCACACGATCTACTATGTGAAGACGTGAGGCGTAAACCATTATGCAGAGAG
AAGTGGTACAGCAGATGCGACTCAACCGCATAAAACAGCGCAAGACGAGAAAATATGGATAGCTAACCTCAAGCTTTACCTATTTAGAGATGTAACCAAG
TTGGGAACCGTGGAAGCAAAAGAAAGTGCCGTGATTGCCCTAGACTACGTGGTAGATGAAGGCGGATTGTTGTATTTTTGCCCGCGATCGGCGACAAATA
TCGTTAATCGTGCTGAAGTTGTTCGTCTGGTGATCTCG