Description :
From Genome Similarity Track
Location :
Scaffold_314:40738- 48894
Sequence
8156 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCACCGCGGGTAGACTG
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGACTGGCATCTTCGG
GATGGAAGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGCTAAGCCGTATGAAGGGAAGGAAGGCGAGAACC
TTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGCCG
TGCTAAGAGTTGGGTGTACACACGGGAAGCAACCTCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTTCGAGCCGCGTTCCTCCCGGCG
AACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCC
TAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAG
CACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCT
CCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCAGGTCCACCGAACAGCGTGACATCCGCTGCTTTGGCTGTGGAAAGATGGGCCACTTCA
AGCGCGACTGTCCTGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGCACAGGGGAACGC
CGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCAGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTC
TTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGAAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGACTCTGG
GGCGTCGAAGAATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTG
CGACTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCG
ATATGGATCCATTTGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGTGAGGCAAGGCAATCGGTGCCAGCCGCCCTGC
GCAGTCCGATAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGACGCCCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCAGGTGCTTG
GAAGTCGTCGACGTATTTGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAAAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTA
AAATAGTTCCGCAGACAGCTGCAGCTGTCATAAACACTGAGAACAGCGTGTTCAGAGGGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTCAGCTGA
AGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGT
GTGGGTAACACAGTGCCACACGCGGTCGTCCAGAACTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACCACAGTACCACACGTGGCCA
CGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAAACGTGGGCAGCAGAGCTCCCCGTCACAGCCGCCGTCGGCAACGACGCCGCCGCCGCCTCAAGTC
GGATCCGAACTTCGATTTGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGACGGAAGAGTGTTATCACATCTTC
GATGGCGAGACCGGCTTACCCGTAAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGT
CTTTCCTGACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGTGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGA
GAACGTCCTAGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGAGCCAGTGTATTCTTTGGTGACGGAGTAT
GCGGACGTGGTGAGCAAACACCCACCGACCCAGCTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGA
GGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTC
GACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGCTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATC
CCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTGCAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCG
ACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTAGCTCGTCATGCTGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCT
GGTGACGCAATTGTTCCGCCCTTTCCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGAAGGCAAGACGGCCATGGAG
GTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAG
TTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCG
AAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCAACCTCCTTCAGAAGGACGTCGACTGGC
GCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGCGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGT
CGTCTGCGATGCCTCCGATTACGCCACCGGATGTGCATTGCTGCAGGCCGGCACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAA
GCCGCCGAGCGGAACTACCCTGTCCACGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTG
TGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATACAACTT
CCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGAT
CTATGTGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTATGGCCGGAACGAGCGCGAAGTCCGACTGGCTCT
CGTTGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTACCGGGTGGAGCCAACTGATCCTCCACGAGCGGTCGTACTCAA
CGACGAGGATCTAAAGTTCGACATTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTC
ACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGCTCA
CTGCCGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACCGAGCGCGTCAA
TCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAAGAACGCGGTG
CACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTG
GGGAAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATTTAAGACCAGTTTCGCTGCGGAAAGGTGGAATCCTTTATGGATACCAAGCTGAGCATTG
TCAGCAGGGTCCGCGATGCCATGGCAGTGGCCCAAGATAAACAAAAGGAGTACTCAGACAAACATGGAAGAGGAAACTTAAGTATATTTGCGGTTGGGGA
CTTTGTGTTACTAGACACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAACCCCGCTTCATCGGACCTTTTGCAGTCCTG
GCCAGACATGGTACGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGG
GGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCCAAGCGAGGGCCGGTCACAGTCGTTGACGAGGTCGTCGGAGCAGGCACCCAAGCCTCGGTC
GGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCAAGTACGCTGAGTACGCCGAGTACGCAC
CATACGCGTACGTCTAGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGAATCATGCGAAAAGCCTCGTCCAGATCGGACGA
AGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCAGCCCGCAAGACGAGCGAGCACGCCCTGATTCCCGGCC
TGGGCGGCAGCATTACCGCTAGTCCCAATGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCG
CAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACAAGGGCACCCCCGCCCCTGCTTGGCCGGAATGGAGAAGTCC
ACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCCCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGA
GTCGATTAAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAAC
GGGGTACGGACAATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATGCGCTTGCTGATCAA
GTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCGGCTGATCTTCATGGAATTCCCGTAACTCCGTGGGTGAGTACTTAAGAGTC
TTCACCCACGCCCAGAACATGTCCTCGCAAGAACTCCACGTGGGACAACTCTCGGGTATAACCCAGGGGTATCCCCAAAGTGGATAGAGACCAACCCGGG
TCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTG
TGCTTTCTAAACAAGGGCTCGTTCATAGATGCTCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCA
GAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGCTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGAACCCCCACGCACACGCTGGGCAGCTTGGA
ATTCCTCTTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGA
GGAGTCGAAGATACTCCGATAGGAGCGACGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCTGTATGCTTCTTTGAGGGCTTGGCACCTTCGGCT
TTAGAGGCCGTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTGA
CGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCTTGCTCACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCACTGAGCACTGG
GCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGATCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAACCGAGGG
TTCGGACGGTTGTCTGAAGATGAGGGCGACGAGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGAGGAACAGATCGCCTCGGAGGCCA
CCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCGTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTGTCTTAGCACCGCT
CTTTGCAGTGCCACGAGGCATGATAACGGTCGAATTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGC
CGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTCACGAACACCTCTTCATTCTGATTGGTCGGTAATCCGAACATAAGTGG
GGGAGGATGTAACGAGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATT
TGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAACGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAACCTA
CCTATAAATATACTCAGCTTACAATCTACCTTATTTAGGTCACTTCGCCCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTA
TACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAGAT