Description :
From Genome Similarity Track
Location :
Scaffold_554:4073- 6118
Transcript NameFunction/comments
Phyag_g6586serine/threonine protein kinase

Sequence
2045 bases(100 bases per row)
ACCCACTCTCATACAATACTAATACGTTCAACCCCTGACAagcagcatgaagaagacctcgACTCGGGTCACCCAAGATCGAGTTCACCCGCTGGGGCAC
AGTTGCAGTTGGGATGGACGTGCGCAAGTTCAACACGTCCATTGagcttttcagccaatggaCTTGTCGCGACGCGGCGATAAAGTCGGCGATTGGTCAG
AGAAACCGCTCTATGCGCAGCCCTAATCCGCGCGCGCCCGATTCCAGCCTCAGACGCACAGACACATAGCAACCACCCAGCTCCCCAATGCAAGCCAGCA
CCACTAGCGGAGACAACAAGCCCAAGCCCAGCCTCCCGCCGACTTCGCCTCCCGTGCCTCCCATCCCGTCCCCGATCCGCCGCAAGAACAGCACCGACGA
CTTGGCCGCCGAAGTGTCCGTGTCTCCCCCCGTCCACACGCCGTCGGACGCGCGTCTGCTGTATCGCGAGTGGCGCACGGGATCCCACGTTGGCGCCGAC
TTGGCGCGCCTAGAGACCGGCGGAGAgccgctcagcagcagcattaatagcaacagcagcggcaacagtATGAGCAGCGAGGACGTGCTCAGTCACTCGC
CCTTCGGCGTCTACGGCCGCTCGCCCAATTCGCTCCCGCGCATCGCCGAGCGGCTCGAGAACCTGCCGCTACGCGCCAATGTGCCCCCTCCGGCGCCTGT
AGATCCGACGGACGCGGACGCCCGCGCGCGTCTTTTGTCGCAGAAAATTGCCGCCATGGACGCCGCTGCAGGAGAACCACAAGCAGCGAAACCGCAGACC
GGATCGTACGGCTCGGTGGGGACCAGTGAACCTGCTACAGGgatcaagaaggcgcagAGTTATCAGGCACTAGCTGATCTGGAGAAGAAAGGGTATTTCC
CAGTGGCACCCAAACCCTCGGCGCTCGGAGTGCAGAGAGGACTGAAAGATTCCGTGGTGAACGATATGTGTCGAGCGGTGGTGAAGCACATGGTCGGTGA
CGTGTACGTGTCAGCGTCAGGCTCGTATGGACAGCGAAAGGTGCTCAACCACCTGTACGAACCGGTGTTCGCCTCGGTGCAGGCCCATTTTAGACGTCTG
CCAGCTAGATACGCACTGTCAGTGAATCCGGACGACGTGCCACTGCATATGAGGCTGTTGGCACAGAACCAGCGCGACCCGACGGCTATTGCAGTCAATG
CccagctcaagaaggacgacaaCGGAGAGTACGTTGCAGTCTGTGCTGTGGGTGGAGATCATTTGTGATGTGGGAGCTAAAGTGTGTGGATTTGTGCTTT
TTGTTTGCAGGATTGTGCCTAATGTGtgcgaggtggtggtggtgtcatTAGATCGAGAAAATATCCTGGATGCTATTACGCGCGGACTGACCACGATGAA
GGGCAATATTCTGGACGCCGACGTGATGACCACGGCGGacggcacgctgctggatcgCTTCGTAGTTAAAGGGTCATTTATGAGCGATGAGCGccaggac
gagctgcgcacACATATCGAGCAGAATCTACGTAGACTCAGcatggaggaggacacaCGGCCGAGTGTCTCCAGTGTGCAGGAATCGGGTGGCGATGAAA
ACGTGAGTCTGGCAGAGAAGCTGGGCGTACTGCAAatggtggacaagaacgagaTTAAGGCTGAATGGAAACTGGACCTTAACGAAGTACGGCTCGAGAA
GGCCGTCGGCGCTGGCCGCTCTGGCAGTACGTACAGCGCATGGTGGCGTGGCACGCACGTAGCCGCCAAGGTTGTCGACTCGTCCACCAATACTCAAGCA
GTTGGCGAAGAGTTGCTGAACGAGTTCCACCGTGAAGTTGCAGTCGTCAGCAAGTTGCGCCACCCGAACATTGTTTTGTTCCTCGGAGCGGCCATCAACC
CGCCCCGTTACTGTTTAGGTAAATTTCCTGTTTACTATTTGCTATTGTGTAGATAGGCAGGCCTTCGCTGACGTCATTTCACAATTTGTCTGTCCCCATT
GCAGTTTTTGAATTCATGGAAAATGGCACGTTGACTGATTTGATC