Description :
From Genome Similarity Track
Location :
scaffold_3:407277- 409014
Transcript NameFunction/comments
g6186.t1 hypothetical protein PHYSODRAFT_312945

Sequence
1737 bases(100 bases per row)
GTTCCTTGCGCACGCGTTGAAGCCACGTGGCAGCCTTTTGGTACGAGTGGTTAAGTCCGTAGGCTTCCTCAAAGCAAGACGCAGCTAGCTCCAACTGCTT
CTTACTGTAATGACAAAGCCCCATGTTGTGACTTGTAACGTGGTGCTTGCCCATTTCTTGCGAGGAGAGGGTGTAGAACGCGAGTGCGCTGTCGTACTCG
TGCAAACCGTAATAAAGGCGACCGATTTCAAACGCCACATCCTTCTCCTTGTCTAGAGCGTAGTAATTCTTCCAGACCAACGGGATTCCGTACATCACAT
CCTGCTTCAGTTTGGCAGCAGCAGTCGGTGACTGGTCCAGCAACACATCTCGGAATTTGTAAAACACGTCCGGATCCCACCCGCTTAGCTTCATCAGCGC
TAAGACGGCCTTGAGCGACGGCGCTTTTGCATCCTCCTTTGTGGATTTTTGCATCACAAAAAAGTCGTTGGGTCCAAATGATACGATTTCATCCTCAAAA
GCCGTCGAAAGGTTGGGGAACTGTAGGCTGCGTTTCTCGCATGTCTTATCCAGTCTGTCGCCGTACAGTTCCGTCATTGTCGAGCTGGCTGCTTCACATT
CACCAACAGCGTTGGCCGGTAGTACGAACGCGGACACCTTAAGGCTGGCCTCTTCCTGAGGGCTATGTAACGCGAATCCACCTCGGCTAGCAAAGTAGAC
GCCAATAGCGTGATAATTAACCATGACGGAGAAGCTACCATGCACGGCGATGTGCGGGTCGCTAACTCCCCGGAAGTGGTCTGGGTTGTTGTTTCCCTTA
TCACCTGACAGCGCGACGAGACCATTCTTGGACAGCGCCGCAAGGCGCTCGATGGCCGTCAGAGCACCGATGGGCACGAGAATCGTGGCGCCCGAAGACG
CCGGATCAAAGTATTCATGGTACCATTTCAGGATGTTGTTGCAGTGAGGTTTTGCCTCTCCGTAGTACGTTTCGTCAATCTGCTCGTACTTGAAGTTATT
GCTCAAGCGCTTGATGATCTCGGGGTCTAGTGGGTCAGGCTCCTCCGCACGCTTCGAGCCAACACTCACAAGACCCTCCTTCAAAACACCCTCGGAAACC
TGGAACAGGTCGTGGTACAGCGTGTCGAATAGGTAATTTGCAATGAGACACAACGGATTGGCCAAGTCGCCCGGGCGGATGACCCGACCCGACGAATACA
AACGCAACTCCGTGTCGGTGGTGGCGTCAAAGATGGCAAAGTCCACAATTCCGCGCTTGACGAACGGAGCGAGCGCTGGGTGCGTCTTCCAGAAGTTGAA
GTTCTGCTCCGTGAAGTCCGTCATGATGTAGCGGATGTTGCTGAGCGGGAAGTCCAACACGCTCTGCACAGGCCAGAAACAAATAACCGTTAGCGTCTCT
GTTGCTGCATTCGAGGCCGGTAGCATCCGAAGCTCACCTCCATTTGCGCGAGTGCCTTCAACAAGTAGAAGCTGAACTTGCCCGAGCCGGCGCCAAGCTC
CACAATGTAAAACGGCTGCGAAGGATCAACGGGTGAGCCCGAGCGCGGCTTCATCGCGTCTCGGAAATACGCACGCAGCACGTTGCTATAGCGCTTGGCA
ATGAACGTGTTGGACGTGATGAAGTGCGGCACGATGCCCTGCGCCCAGGACTCGACGCCCTGGCGGTCGTAGAAGGACATCATGAGTTTCCAGAGGTGGC
AGCGCGCGAAGGGTGTGAAATCCTCCAGCTGACAGCG