Description :
From Genome Similarity Track
Location :
scaffold_19:407256- 408558
Sequence
1302 bases(100 bases per row)
tTCAGGATAATCGCACaattgtgtggctacaccgtaacaagaagtcactatttggcgggactgccagtaattatgcgttttaatcaggttttactatttt
atttaattaggaTAATCTGGAGATTTAAATATAGGTGGCTTTAcctcaaataaaacaatagAAATACCGTTTACAATTTGAGccgaagagtgtatttgtc
ttgggttaaggttctgGATACTCTTGaagatagcggattgcgatccactacactcataatggttctagtatagaacgtaaggtcggtgaccttagcaagC
TCTCTCTAAACAAAGAggtacgacagccccgctacagaaACGGCCATAGATACAACACACAAAGGTTGGATTTTGTATGTTTTACCCGGAACAAGTAAAT
ACCCAGAACCTGGATTTCGCTCTCTGCTAATTCGAGAGTAGCATACATAGCTAAACTAATAAAAAATACTGCATCAAGTTATGAGAGTATGTGTTTTGCT
TGACGTGGGTCTGATCGAAGATAGATACTTGCGCCTAAGTTGCCTTAAGTCATCATGCTAAACTAATTGTAGCCTTACATGCCAGAGTGTGCGGATCTTC
TGCACACAGAAGGCAAAAcgagcacttgtagtcgcACTGCAAGCGCTTTTTGACCCCACGGGTCACGATTTGTCAGAAGTACCGCCTGTACTTGGTAAAT
CTACATTTAGGTGAATCTGTTCTCCATCAATTTTATACTTTGAGTACTCAATCATGGCAAGAGCATCCAAACTCGATCTGCACACTGGATTAGAAAAATA
CATCGTCCCACACGTCTTACAGATTTGCAAGCCAGCTTTAGTAAAACCGATTTCTGAATTCCCGACTTTGAAAAACACGAAGCGGACGTTTAGGTGGAAA
CTCGTCGCTATCATCAGCTTCGCTTGTATTCATTAGACAATTTTAACTACCAATATGCAAGTCTTGCAGTCACAACAAGGTGCTTCCCACTCAATAAGAG
AATGTGCTGCGCCGAGCGACACTGCTTCAACCTTAAAGAATATGGTGTGTTGGATCATAATTGGAAACAGCACTTTGATGGTTTTATCGAAGTGCGACCT
TGAGCTCGAATATATGTCGAAGGAAAGGTAACTTCTACACTTTACCGGATACTAGCTACCGCTCTAGTATACCCACCGGCTTACTGACCGTTACGCGTCC
GAATTTGGTACCCTTCTATCCGAGCAGTGAGGGCGGAGACCACCCTACAGCTTGCTTGGTGTCACCTCCATTCTGGCGACATGACTACTCTCTACGACTT
TT