Description :
From Genome Similarity Track
Location :
Scaffold_15:40712- 41950
Transcript NameFunction/comments
Physo_131239reverse transcriptase

Sequence
1238 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATCCTCCGGCAAGAGCTCCTCGTCGAAGTCGAAGCGCTCCTCGGCCGG
CACCGTCAGCTGTGTCGCGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGGGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGCCGTC
TTGAGGCGCACTGCGAACGCGCTGACTAGCTCGGCGACGCGGAAGGGTCCGTGCCACATGTGCGCGAGTTTGCGCGCATACCCCGGCTTCACCCGATCCA
GGTACAGCCAAACTTGCGAGCCCGTCGCGATCTCATGTTGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTAGCT
TGTGCCCTTGCCACCTTGTAGTGTCGTTGAATACGGAGCCTCCACCGCCTCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGCGTCGCTTCCA
GCGTCGACCGAGGATCCCAGCCGTGCACGAAGAAGAACGGGGTTTCGTTCCTCGTTCGGTCGTGCGACGTGTTTAGCGCGAAGGTAAGACGCTCGGCGTA
TTCGTCCCAGTCGCGTTGGTCGACGTCCGCGATGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGACGAT
AAGCGAGCGTCGCTCGCTGTCTCTGACCCATGAGTTTGCTGAACACCTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCAGATAGCCTCGCT
CGCGCCGAAGCGCATAAACACCCCCTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCGTTCGCTTTGACCACGACGAACCCCGTGAAGAGG
GCGACCCAGACTAACAGCTCTGTGTTGCCTTTGTAGGATGCCGGCAACGACGGAATATAGTCCATGGCAATGACCTGGAACGGGTACGTCGCGACTATGT
TGCCCGGCGACTCGCCCTGGATGGTCGGCCGACCCTTCCCCGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAGATCCCTGGCCA
ATGGAAGTGGCGCCTCACGCGTTGGTACGTGCGGCCAACACCCTGGTGTCCGCCTTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAAGAGTC
TCCGGGATCACCAGCTTCATCATCACATCGCGATCCTC