Description :
From Genome Similarity Track
Location :
contig_3:407054- 408791
Transcript NameFunction/comments
g840.t1hypothetical protein PHYSODRAFT_312945

Sequence
1737 bases(100 bases per row)
GTTCCTTGCGCACGCGTTGAAGCCACGTGGCAGCCTTTTGGTACGAGTGGTTAAGTCCGTAGGCTTCCTCGAAGCAAGACGCAGCTAGCTCCAACTGCTT
CTTACTGTAATGACAAAGCCCCATGTTGTGACTTGTAACGTGGTGCTTGCCCATTTCTTGCGAGGAGAGGGTGTAGAACGCGAGTGCGCTGTCGTACTCG
TGCAAACCGTAATAAAGGCGACCGATTTCAAACGCCACATCCTTCTCCTTGTCTAGAGCGTAGTAATTCTTCCAGACCAACGGGATTCCGTACATCACAT
CCTGCTTCAGTTTGGCAGCAGCAGTCGGTGACTGGTCCAGCAACACATCTCGGAATTTGTAAAACACGTCCGGATCCCACCCGCTTAGCTTCATCAGCGC
TAAGACGGCCTTGAGCGACGGCGCTTTTGCATCCTCCTTTGTGGATTTTTGCATCACAAAAAAGTCGTTGGGTCCAAATGATACGATTTCATCCTCAAAA
GCCGTCGAAAGGTTGGGGAACTGTACGCTGCGTTTCTCGCATGTCTTATCCAGTCTGTCGCCGTACAGTTCCGTCATTGTCGAGCTGGCTGCTTCACATT
CACCAACAGCGTTGGCCGGTAGTACGAACGCGGACACCTTAAGGCTGGCCTCTTCCTGAGGGCTATGTAACGCGAATCCACCTCGGCTAGCAAAGTAGAC
GCCAATAGCGTGATAATTAACCATGACGGAGAAGCTACCATGCACGGCGATGTGCGGGTCGCTAACTCCCCGGAAGTGGTCTGGGTTGTTGTTTCCCTTA
TCACCTGACAGCGCGACGAGACCATTCTTGGACAGCGCCGCAAGGCGCTCGATGGCCGTCAGAGCACCGATGGGCACGAGAATCGTGGCGCCCGAAGACG
CCGGATCAAAGTATTCATGGTACCATTTCAGGATGTTGTTGCAGTGAGGTTTTGCCTCTCCGTAGTACGTTTCGTCAATCTGCTCGTACTTGAAGTTATT
GCTCAAGCGCTTGATGATCTCGGGGTCTAGTGGGTCAGGCTCCTCCGCACGCTTCGAGCCAACACTCACAAGACCCTCCTTCAAAACACCCTCGGAAACC
TGGAACAGGTCGTGGTACAGCGTGTCGAATAGGTAATTTGCAATGAGACACAACGGATTGGCCAAGTCGCCCGGGCGGATGACCTGACCCGATGAATACA
GACGCAACTCCGTGTCGGTGGTGGCGTCAAAGATGGCAAAGTCCACAATTCCGCGCTTGACGAACGGAGCGAGCGCTGGGTGCGTCTTCCAGAAGTTGAA
GTTCTGCTCCGTGAAGTCCGTCATGATGTAGCGGATGTTGCTGAGCGGGAAGTCCAACACGCTCTGCACAGGCCAGAAACAAATAACCGTTAGCGTCTCT
GTTGCTGCATTCGAGGCCGGTAGCATCCGAAGCTCACCTCCATTTGCGCGAGTGCCTTCAACAAGTAGAAGCTGAACTTGCCCGAGCCGGCGCCAAGCTC
CACAATGTAAAACGGCTGCGAAGGATCAACGGGTGAGCCCGAGCGCGGCTTCATCGCGTCTCGGAAATACGCACGCAGCACGTTGCTATAGCGCTTGGCA
ATGAACGTGTTGGACGTGATGAAGTGCGGCACGATGCCCTGCGCCCAGGACTCGACGCCCTGGCGGTCGTAGAAGGACATCATGAGTTTCCAGAGGTGGC
AGCGCGCGAAGGGTGTGAAATCCTCCAGCTGACAGCG