Description :
From Genome Similarity Track
Location :
Scaffold_26:407- 85244
Transcript NameFunction/comments
Phymu_g1615hypothetical protein
Phymu_g1616hypothetical protein
Phymu_g1617hypothetical protein PHYSODRAFT_350602
Phymu_g1618hypothetical protein PHYSODRAFT_489802
Phymu_g1619hypothetical protein PHYSODRAFT_489031
Phymu_g1620hypothetical protein PHYSODRAFT_313255
Phymu_g1621hypothetical protein PHYSODRAFT_542020
Phymu_g1622myosin-like protein
Phymu_g1623hypothetical protein PHYSODRAFT_313225
Phymu_g1624hypothetical protein PHYSODRAFT_259487
Phymu_g1625hypothetical protein PHYSODRAFT_313223
Phymu_g1626hypothetical protein
Phymu_g1627hypothetical protein PHYSODRAFT_496973
Phymu_g1628hypothetical protein
Phymu_g1629hypothetical protein PHYSODRAFT_491102
Phymu_g1630hypothetical protein
Phymu_g1631hypothetical protein
Phymu_g1632hypothetical protein PHYSODRAFT_495691
Phymu_g1633hypothetical protein
Phymu_g1634hypothetical protein PHYSODRAFT_491292
Phymu_g1635hypothetical protein PHYSODRAFT_495212
Phymu_g1636conserved hypothetical protein
Phymu_g1637protein phosphatase PP2A regulatory subunit B
Phymu_g1638protein phosphatase PP2A regulatory subunit B
Phymu_g1639putative malonyl-CoA decarboxylase
Phymu_g1640conserved hypothetical protein
Phymu_g1641hypothetical protein PHYSODRAFT_354319
Phymu_g1642hypothetical protein
Phymu_g1643hypothetical protein PHYSODRAFT_313206
Phymu_g1644hypothetical protein

Sequence
84837 bases(100 bases per row)
ACACTATATCATCGTCCCCAGACTGCGCGAGTTCCCCCAGCCGGACTGCAAGAGATCGTGCGCTATTGACCCCGGCGTGCGTAACTTCGTCACGGTGTAC
GATCCGAACGGCCGGACGCTCAGCGTGAAGGACTCGCGCGGTGTCTTAAAGAAAAAGTTCGAggcggtggacgagatgaaaTCCATCCTACAGAAGATGA
ACAACTTATGCAAGTCGCGGCACCTCACGCAAGTTCGGACGAAGGCGAAAAAGGGGATCAACAGTTGCAAGTCAGCAGAACACCGGTTACGATACCGCCT
GCGCAGACGGATCCGATTCACGTCTCGCAAGGCTACTCGCACCGTCAACGACATGCACCAGAAGCTCTCCAGCTGGCTGGCTTCGCGATACCAGGACGTC
CTCCTGccgtcgttccagacgtcTGAGATGGTGCGCAGGTATTTCTTGGAGGTAGCATCGGACGCTACCCCAGAGGCCGCCGCCACCGTTCAAAAAAGAA
AGATCAAGAGCCCGACCGCGAGAGCTatgatggcgctggcgcagTACAGGTTCAAGATGCTATtgaagtacaagatggaGCGGGCCGGCGGACGCGTGAT
CGACTGCGAAGAGGAGTACACCTCGAAGACGTGCTCCAGTTGCGGcgagatcaagaacaaccTTGGCGGGAGCGACGTGTTCCGATGTTCGTTCTGCCAC
GGGAGATacagccgagacgtgaacgccgcgaggaacatcttccacaagaacatggggTTGGTTCCGTAGCGTTCCTACATATTAccggcgaagccttcgt
cgcggagtccTGTCCACCAANGTCTGACATTTTCTGAAAAATCAAATTTGGAACTTAGTATAAATGTGTGGCGACGATCGCAAATCACAATTTGCACAGA
AGACGGCAGACAAGAATCCGACCGAAATGGAGGGGCTCGATTGGGGCTACCTAAAAAACCAAGTTCGCCTCATTCGCGAGAACACGATCACATCTCGTTC
TCGCACCACCTACCAGAACTCGTACTGTCGTTTCTTAGTATGGAACATTGCCAACAAGCCGAACCTCATCTCACCGCAGTTTACGGAGAAGCTCGGTGAC
ACTACAGCGCTCTCACTTCAGCAGCTAAGGACGCGCGTGAAGGAGACCGTCACGCAGAACCTCGGTATCGCTCCACTTGTCTTCGATGAACTGACTGCGG
AGGACTTCGTCACCTGGCTAATTACGCTGAAGCGGAACGACGGCGAGGCGCTGAGCTACTCCGCCCTGAACACACACAGAGCAGCCCTGTTTAATTTGTT
TCGGGACTATGGCCACACAATGAACAGTACACTGGAATCCGACTTGACTACATACTTCAAAGGTTTGAAGCACAAGTTAGCGAAGGACGCATCGAATGGA
GCCAGCGAGATCAAAACCGGTAAAGATCCTCTCATGTTTGATTTGTACAACTTCCTATGTGATAAAAtgcttgctcttcctggAAAGGAGATGCCATTTT
CTCACGCCTACATGGTTATTGCGTGGAATCTGATGTGCCGGTCGTCGAATGCTTTTGGAATAAGGCACGCGCACATGGAGTGGAGAGGCGACGCACTACA
GATTTACTTTGCTCACATGAAAAATGACCAAGGTGGAGATCGCCCGCGAGACCCCCGGCATCTTTATGCCAACCCTCTACAGCCTGCTATTTGTCCCATT
GTTGCTTTGGGTCTGTACTGGGCTTCTACGGAGTTCGATACGAGCGACCTTCTATTTCCTGGTAGCAACCAGTATGAACGCTTTAGAAAGggcctgcagc
gccttcttgctgacgaagaagtcgccGCTGAGCTCAAACGACAAGGTCTGGACCCCAGTGACTTGGGAACACACTCGATGCGGAAGGGATCGGCCACATT
TTGCTCGTCAGGATCGACGGCCTGTCCATCGTCTACAGCAGTCCATTTGAGAGCTGGTTGGTCACTGGGCGGTGTCCAAAACACCTATCTACGCTACGAA
GCGGCTGGAGATATGCATGTTGGAAGGACCGTGGCGGGACTGCCAACAGAAAGCTACAAATTCTCAACATTGCCACCATACTTTAAGGAAAGTGATGAGA
TTGTCCAGCGTGGAGTTCGTTTGGTGTTTCCTGGTCTACCGGAACGGCTGAAGTTCATCGCTGAATATTGTCTCGCATCACTAACGTATCACCACACCTA
TCTCGCTGCGTCCCTATCGCCCAAGCATCCTGTTTTTCATTCACCGATATTTCAAGATgcagatctgctgcagtcgcttgtCAAGCGGGTCCGGTCTGGA
GATGGGAGCTCCGATGCTCGTATACGCGCAACCGGTGTACCGCCACACGTTTCGATCTTGTGTGAAATGAAGTGGCTGAAAGACAATTTGGTAGATACGC
TGGCCAAAATTGAGTCTACTAGGGTGGATACTGTGAAGGACATTATTGAGGAACTAGAAAAACGAGCAATTGGTGCCGACACAGTCACGTACGATGGCCT
CAATGCAGCAATTTCAGCATGCCTCCAGGATTGTGGTGTAGCAGACCTCGTGCAAACGCTTGCAGCACCTGTGCACCTCCCCACGGAATCAAACGAGCAT
AATTCCGAGCGCACACTCGCTCATTTCTGGGGTGGGAAGTTTCGCCGCGTAGCACAGGACTTTGAAATTCCTGATGGTTCTCCCCGTCAGCTTTGGGTAT
TGTGGCGGTGCGGGAACAAGACAAAGCAGATACCACCGCTCCGCCTACTTGAAGGCAGAGATATGCCAAcgcgcaagctgcagaaacGATTGAGTGAGCT
TCGGTACGTGATGCGCCACATCGAAAAAGATGCAGACCTTAAGAACCTACTGTCCCCCGAGCAGACGATTGAAGAAGCAACAGACGTGTTTCTTGTCTGT
GCTCACAGTGTTGAAGTGGACCAGGAGACCCGACACGCACGGAAGCGACGCTGTAGTCAATTGGGCTGGGCTACCGTCGGAAAGCTACTACGCAAGAAAA
GCAAACGCGCCGACGCCAACTGTAACATCATTTCTGCGTAGGCCGTGAGATGTTAGCCAGCAATATTGTCGCAGACCCAACTGCACGTATATATACCCGT
ACTGCATTGccttcgagtacatgtactgtaccacaATAAAttactgtacagtaccgtatGTCTGCCTAAGTTAATCACGCAAACNaatcagcgacgattt
gaggtCGTCAgcggtggtcattctcagatattatcagacttAGAAAGAAGATATTCTCGACTCAGTCAACTGACAACGACTATTGCGATGCATTGATTGC
AGTTAgattcgagctgctgcttgcttAATCCCAGGCGGTAGATCTTACGAACTGGCACCTGCGGGTAATCGAAAACGTAAGCGAGTATTAATATATCGTC
TTGCATTTTGTCATCGAAGAATTGACTTTAAAGGGCTTTGTAGAAAAGTGCTTTTTGATTTTGGAAATTACCGTTGGGAAAACATCCTGAAGCCTTTAGG
TCCATAATTTTACACTTTAAAAAATGGCTTCCATAATTCCTCTTCCATAAATTATGGTTGTAAAATTACCACTACGGAACTCAGGCCATTATGGACTGTA
ATGGCGGATTGAATTGAAGCAAAATCCTACGACCAGGACTCTACGACGTAGCGCTTCTTGCGggccagcgtcttcatgatcttctcggCGGTTGGCAGTG
GGATTTTCCCTACAGAGCGGAGGATATCACGTAGAACCTCGTAGACGTCGTTAGGCATTCGCTTGGCGGACCCGGCGATGTAAATGCAGCCCTCGCCGTT
CGTGATGAAGTCGAATACAGCCTCCTTGTTCTCTGCCAGTCGTGTCTGCACGTAGATCTTGTGGTCCTGTAGGTGCGACACCCACAAACATGGTCATAGG
TCATAAAGGTGGCAAATGAGAGTGAAAGGACTGCAAAACGAGGGATGTGTACCTGATCACGTGAAAACGCCGTGTGCAGCTCCGTGAGGTCGCCAGAGGT
TACGAGcccacgcagctcgtcgccgtAAAGGAAGTCctgtacagcagcaacatatCGTTACAGTCTATAAAGTCATTCCGAGCACTACAGTTGTAGGCTC
CACACCTTGTTTTCGTGGCGGCATCCGAAGTAGAGATGCGACGCCCCTGAGTTGTTACCACCAGCTCGTTTGCGCAGGAATTGGCGCTCCTGTAGCATCG
CTCGCATGCTGGCAAGCCCCGTGCCAGGTCCGATAAGTAACACATCGCGCTCTAAAGCGGGAGGCTCAAAGAGACCCTTCTTGATCCACATTGGCacgat
cttctgctccttggaCGGAGCCAGCGATTGAAAAAACGACGAGCAAATTCCGTAACGACGACGTTTGTACGGTGTCAAGAAATCCACGATGGCCACCGTC
AGATGCACCTAGGTCGTAACAAAGAAGAAACTTTAGTAAGAACGCGCCATCAACACGTACAAATACACAATGTCGCTTACCCTTCCAGGGTGGAGGAGGG
CTGATGACGAGATGGAGTACGACCGGGGCTGTTGGCGAGGAATGAGCTGCATCAGGATGGTCAAGGGCACGTCCACGCTCGGGAAGTCCGGTAGTACTTC
AGCGTAAGTCTTCTTCTCACGGATGCAGTAGTCGTAAAGCAGATCTACACCCTCAGCCGAagccagctcttccagtttcTCTTTCTACGTAGCCAGTAAC
AACAGGAATTCGACGTTAGTGCATCACAATTATGTCCAAAAGCCAGTAGCAGACATTGAAACGGACCTCCTCTTCATTTGACGCGAACAGGGAGAGTCTC
TCGAAGAAGCTTCGGCGCGGGATTTCCAGAATGGCGAGATACTTGGCGAACAAATCACGAACAGTGATCGGCGAAGGCAAATCCAGCTGCTTGGAGCCGT
CGGCCGCGTTGATCGAGATGACAGTGTCTCCGTCCATCTTCACGTACTGGAGCATATCGTCCACGCTCGCCACATTCTCGGGGTACACTACAGCGATGTC
TCCAGCTCGGAACGGAGGTTCAGTAGCGTTATCAACCGAACCGTCACTGATGTCAAACTCCAAGTGCCTCACATCTTGCTCCCAGCCCTCAGCCGTAAGT
CGGTTGTTCACGACGACTGGAGCCAAGTAGATTCCCTTCTCACGACCCACTACAGTGCGTGGCGGAGCGTAAAAGTTTGATTCGACCGTTCTTGGTGTCA
AAGCTTTCGCCTCGTGCACCTTATTAGCTGCAGCATCATGTATAATGACGGAGTAGCGAGGTTCGAGAGGCTTTGGCGAGTCGTCAATTTCCACACCCAC
AGACAGCGGATATCGCTGCAGAACTGccgtccagagcttctccagccacGGATTCAAGGCACCAAAGTATCCGTAAGCGTGCTGGTCGTCTCCGAGCCCT
CGGTCGATGAGTTCCGAGGCTCCGAGCTGCAGTAGCCGAGCCTGCAGGCGTCTAGCAACGGCGTTGTACTTGGCGTAACTGGAATCGCCCAGCCCGAAGA
CAGCCACGCGGACTCCTGCGAGCCATTGAGCCCCTAACGTCTTGCGCAACAGACTGCGCCAGCTGTTGCGCATATTCTCGGGCGCCTCGCCGTCGCCAGT
CGTGGACACCACGAACACGACGGTGGAGCATTCAGGAAGTAGCTGTGCCACTGGGAAGTCGTCCATGGCCGAGACCTGCGTGTCCAGCAGGTGCCTGTTG
AAGGCACGCTGCTGGATAAACTCGGCCACATCCTGCGCTGTGCCGGTCTCGCTACCGTAGAGCACCAGCAACCGCGGCGTCGAAGGCGCTGCCATCTTGA
TTGGGCAATGACACGGTTCCAAAAGACTCATTGCAATGAGCATATTTTGTGGACCACACAGTGTTACCAAAAGGTGACGCGCTTTTACCCATTTTGCCAG
ATTGGGATAAAGAGGGATTTTCACTTTTTTCCCATGTTTCCTATAATTTCTCCCGATTGTCTGCTCTCAACATGcgcatctcctcctcgaagtCAAAGCT
AGAACGCTTGCAAACATGTCTTTCACCTTCGTGCCAAGTGTTGCCACCAAATTCGTGCTGGTTGGTGCTATAACTCGACAGCGCAAATATATTTGATGAA
GTGATATATAATCATAAATAGCAGGTGATGAAAAGTGGATACATGTAACTTGAATAGTGCGTTCTTGTTACTTTCGGAGTACTTATCGTTGCTTCTGTCC
GTGTTTGCAGATCCTCAACCGCGTCTACTCCGGCAAGTGTTGCCGTGAGTGGTTCGAGTACAATTGAGAGTGATCCAGCCCCATGTGCTGTGCGAACAGC
ATCACCTCCGTACGCTCGCAAAAGTCGCCCAAATGTATTATCTTTTTCCGGTGACGCAGCAAGCTATTACCTTTTCTATCGCCAGTCATCTCTTGGGAGC
GTACCGCGCTGCCCCTGCTGTGCGGCGGGTATTTGCGCATTGCGTACTTGCCACTCAAGGATGGTTTTGCAAAGTGGAGCTCGCTGGAGCTTGCTCTTCG
TGTCTTGTTTGGTGTGGTATCCCAAGTCCAAGATCACCGGAACTTCCCTGTTGTTTCTCTTGTTTGTTGGAAGTCATGGACACGCACGCGAAAGTGATCG
AGATGTTAAACAGCGTCGTACACTACACCGACGGCATCCAGCAAGCAGCGCGGTACGCTCCCAGAGGCGATTGAAAAGGGCATATCGGTCTGCATAAATA
ATTCATTTGGGTATCAGTTGCGAGCGTACACActgctgctgacgtactTCCATACAAAAGCCAAGTCAACCGTCCCAGCGGTCCAAAAGCCTCCCACCAT
GTTCAACATCCTCAATCCTCGACACTTCCGAATTTGCCTCgccgagctcaagcgccttctcctttcGCCATGCtttcgtccaagatccaccGCTCGGTGC
TGCCCAGTGCTGCCTCAGCCtcgcgccgcttcttccacgctgAGGTGCACAACAAGGAGCTGATCCAGTCCGCGGGCTTCATCAACGGCAAGTGGGTCGA
CGCCCACTCCAACAAACACTTCGCCGTTATCGACCCGTCGACCgacaaggagatcgcgcGTGTGGCCAACATGGGGCGCGTGGAGACTCACGAGGCCATC
GCGGCGGCTCTGGCGGCCCAGAAGAAGTGGCGCAAGACGACACCCGCGGCACGTTCCGCCCTGCTCAAGAAGTGGCACGCTGCTATTGTGGCCAACACGG
AAGATCTGGCCGTCATCGCCTCCGTGGAGAGCGGGAAGCCTCTTCCGGAAGCCAAGGGGGAAGTGGCCTACGCCGCCGGCTTTATCGACTTCTACGCGCA
CGAGATCATGCACTCGAGCGGCTTTATGCCCTCCACCTCAGCTGCGGACCACAAGATCATGGCAATCAAGGAGCCGGTGGGTGTCTGTGGCATTGTCACG
CCCTGGAACTTCCCCCTGGCTATGATCACTCGCAAACTAGGCCCTTGTCTGGCTGCTGGGTGCACCGCTGTGGTGAAGCCTGCAGCTGAGACGCCGCTGT
CTGCTTTGGCGCTGGCAAAACTGGCCGATGATGTCGGTATCCCGGCCGGCGTCATTAACGTGGTGCCGTCCCCTAACGACAAGGCTGCTGAAGTGGGAGG
AGCTCTGACCAGCAGCCATGACGTCCGCAAGATCTCGTTCACCGGCTCGACTCGTGTGGGCAAATTGCTGATGCAGCAGTCGGCCGAGACCGTGAAGCGC
GTGTCGCTAGAGCTCGGTGGCAACGCGCCATTCATTGTGTTCGAAGACGCCGACTTGGACAAGGCTCTGGACGGGCTAATGGCCTCCAAGTTCCGCAACA
CTGGCCAGACGTGCGTGTGCAGCAACCGCATATTCATCCACGCCAGTATCTACGACGAATTTGCCGCCAAGCTCGTGGAACGtgtcaagaagctcaagat
ggGCCCGCCGCGCGAGGAAGGAGTGAACCTCGGCCCGCTTATTGGCCCTAATGCGTTCTTGAAGAcctcggagctggtggaggacgctgTCACGAATGGT
GCCACGGCTCTGGTTGGTGGCAAGCGCAGCGATATCGGCCGCAACTTCTACGAGGCGACGGTGCTGGCTCATGTTGATGACACTATGCGCGTCTGGAGCG
AGGAGATCTTCGGGCCCGTTGTGCCATTGTTCAAGTTTTCTactgaggaggaggtgaTCGAGATGGCCAACGGCACGGAGGCTGGTCTGGCCGGGTACTT
CTTCTCACAGAACTTGTCACGCACGTGGCGCGTTGCGTCTGCACTGGACTGCGGTATGATTGGGGTGAACACGGGCGTTATCTCGAACGTACAGGCTCCG
TTCGGAGGTGTGAAGCAGTCCGGACTGGGACGTGAGGGCTCGTTCATGGGTCTGGAGGAGTACCAGGAGACGAAGATGGTGTGCGTGGGCGGACTAGAGC
AGTAAGTTGCCATTGTGAGTAGTTGCGTTACTGGCAAAATAAAATTATACTACTACGTTGTAGTTCAGACTGTCATGCCGGTAGTGACCACGTTGTTTCA
CCAGTCATCATGTTGTAGTAGTAGGTGCTACCGCTGCTGTCCTGCAACTCTTGCCAGTCACTTGAAGCTTTTGCAGCGCTGACATTCACAATAAACGGAT
TTTTCCAGCTTGTCTCCCCTGTTACCTGGTTGCAATAGTACGTAGCACCACTGCTTTCGTCTCGACATTCAATCCAATCATTTGGCGCTGGATCAACGTC
CTGAACAGATTTGTTTGCTTCCGATACTTCACTTGCGATCGCAGTCTtcgtctcttcttctttcgcCTTCTGCTCAGCCACTACTTGGCTCTGCTCCCGA
ATGAAAATCTGCTGAACGATCGCTTCAGCCTTTTTCCAGTCCTTCTCAACGATCGTCACTTCCAGCCAGCTCATGTGTTGATCCCGGGATGAATATGGCA
CGGGAGTttctcgaagctgcttcacctgTGCGAACAGAGCCAAGGAGATCTGGTCTTCCGTATCGGATGTATCCCGAGCACTTCGAGGGGAGAGAGACCA
TCGCGACTCTCCTGTCACTTCGTTGTAGTAATACGTATTCTGCGTCTCTGGATCAACAAGTTCCACCCACTTCTTGCCGAGAGTGCGAGCTTTTGTCGAC
CGAGTTGTGAGAGTGCTGCTACCGTCATCATTGACTTTTTGGTGGGCCATTTCAAACCATTTACGAGCGGAACTACTCGCGCTTCGCCCACTAGCAAACG
CTTCGTAATTAACGTCAAAGTCTTGAGGTTTTTCCCATCGATATTCGTTCGTCAGTGCGTTAAAGTAGTATGTCATGCCATTGTCCGTATCAATGTGCTC
AGTCCAAATCGGCCTGTGAGTCCTCGAGCTCATGACGAGCTTCCCATTCCCATCGTACTCGTAGCCATATCGATACTGCCAATGTAGAGATCGAGACGTC
CCAATACTACGCGCTGAACGTCGCGAATTCATGGTCGTGTCACCTAACGACGCGTGGACACTTCGTGGAGACAACGATGCTTTGATCTCTCCAGTCGGTG
GATAATAGAAGAATGTGTACTCGGCGACTGGATCGACTCGTCTTTCCCACTGCCCTAGGACAGGCAAACGCACTTGTGTCGTTGCAATCAGTCCTTCTGG
GTCTTGTAGCTGCTCCTGAAGCCATTCCTGGCGTTTTCGAGACGTTTGGCTGTCGGTGAAGTATGCGTTCTCGATAGCATCAGGTTTATCCCATTGGTAC
TCTTTCGTTTCGCTGTTGAAGTAGTACGGAGCTTGGATTTTATCATCGAAAGCTTCGTACCAATTAGACGCAGGCTGCCTGTCGCTGGGAGTATTTTGTA
TGATACAGTGGCTGCTAAGAGGTTGGTGGTCTGCTGATTCGACAGATTCTCTCATGGGCTCCACAAATTCATCTCCAAAAATGTCCATTGCTAGAGGTCG
ATGCCATCGTGTAGCTCCCGTCAATGCGTTGTAGAAATATTGCCGACCATCAGACGATGTCATTTGAATCCAGCAATTGCCCCCCTCTTGTACTGCAGCC
CTTACGCGGAAGCCTCGGAACGTCCTCTGAATAGCGATAGCTGCACGGCGTTCGTGTCGAACCTTATCCTGCAATCTTTTGACGCGGTTTTCTCGAGTTT
TCTTGACGACACCCTCGGTTAACGGCTCGAGCTGTCGCTTAACCCCTCGCAATTGTTTCTTCGCGTCGTTCAGATTCGTAGTCAGTTCTTCAAACGCACG
TCCATCAAGCGCAATCTCGGTTCGTTTGGCCCGTAGCTGGTCCGCTAGCTGAACTTGGAGATACTGTGTAAGGTAGCGCTGAGGCGTGCCGGTGATACGG
CTCGAGTCGTGGTACTTGGTTTTAATCTGAAGTGTTTTCTCGAGTTCCAGCGTCAACGAAcgctcttccgcttcatCGACAGTGGttttgcgctgcagct
gctccactttATCGCACAACTCGTCAACAAGTGCCTGCAAACGAGCATCTTTAGCAAACAAAGGCTTGGCTTGGTGACGGAACCGCTGTAGTTCTCGTCG
CAGCTCGGCGTCTCCCCGTCCTCGGTGACCTCGAATGAGCCGTTGGATATCTGTTGCTGCCTTCACTCGTCTCAATTGCGCTGCcaacgccagcttcatg
GCCTTCATGAATCCTCGAGACGCGTGCATTCTATAGGCGGCTTGGATCGAGTTGGCGGCTTCGTTTTCACGTGCACGTAGTTTAATCAACCCGATCAGCA
CAGCAGCCAAGTGTTTGTCTCGAATACCTCGCCAGTACCGTTGAATAGTTAAAGCCGCATTAAGTATCCGCAATTCGTCGGCTTCAGCTCGTAAAAGCAC
AGCATGTCGTCGTGCTCGGTGGCCACGGAACACCTTCTGCATCTGGATGGCGCCCTGATTGCATTGGCTTTGGTGAAGCAATTCTGCCAAACGTTGAGCG
CGAATGTTGCGTCCTTTGTGGCCTCGATACACCCGCTGGATATACGCTGCAGACCGGAGCTCTCGTTCCTGCTGAAGACGTTTGGCTTCTTTGATTGATC
GTAATAAGGTGGCATCAGAGCGCCCACGGTGGCCTCGGTAAGCTCGTTGCAGCTTGGTAGCCGCTAGATTCTGCATGATCATCACTCTTGCTTGGAATTG
CTGCTCGCAATACATTTCGTATCGCATCTTCGCTACTAGTTTGCGATCGCGATAGCCTCGAAAGATCTTCTGGAAGATGAGAGCTGCCTCGTCCTCGTGC
TCTTTAATCTTCCGAACCCGCTTGGCGCGTGCCAACATCCGACGAAGCTGCAAGTCCCGATACCCGCGTGCAATTAACCGTGATGCCTGATCTTCGAGCT
GATACCGCTTCTCTGCTGCGAGGCGCTTTCGTACGAGGAACCCACGCACTCGTGCTTGGATCAGTGGCAGGATTCTCCGCTCCACATACTTCAGTTTCGC
CTGCCATAGTCCCCCACGAGCAAGGCAGCCACGGATGGCCGATTGGATTTTAATCGCACTCCGCAATTGCAACAGGCGTAGGTCACGTTGGCGGCACAGC
TCAGCGGCGTTGGGCAGCGGCTCGAAcccgaagaagctcgtggccCATTGCACGAATACGAGCTTGGCAATTAACCGCTGAAGGAACCTCCTCCCAATCT
GCTTGCAATTCGTGAGGTTGAGCGTGATGAGGTTGGTGCAGACAGTAGTCAAAGCATTCACTCCGTCCTCTGAAACTCGAGGACACCCTGCCAGACTTAA
CTCTCCCAGAGACTTTGTCAGGCCTCCAGCCCCCGAACCAGTAAGCTCACTTAACGCCGTGTCCCCCACTTTTTGGCATCCTGCTAAACTCAAATACGTT
AGGGAAGTGCAGTTCTGCGCTAGTGAACGTACCCCTCGAGCGTCAATATTCGGGCTTCCACTGATGTCAAGCCACTTGAGCTGCGGACAGTTGGtagcaa
gcagctcgagatcACTGTTGGTCGTCTTGATGCATCCGGAGAGGGACAGGACCTCGAGTTGTGTACACTGTTGCGCCAAAGCGCGAATGGCTACACTACT
GACATCCCGACATCCTGTAAGTCGGAGTGTGGTCAATAGTGGACAGCCTTTCGCAACGGCACGGACGCCAGGATCATGCACGTGCTGACAGCCGAAGAGA
TCCAACACACGTAACTTCGGACAGCATTTCCCAATTTCAAGCAGCGCTTTGTCGCCATATTCCCCCAGTCTAGAGCACTCGGAGACGTCCAAATGGCGCA
AGTCCTTACAGCACTGGGCGATTTTAACGATGCCAGCATCGGAAACCCCTTGACACCGCTTCATTATGAACGTCTCAATCATCCAACAACCTGCAGCTAG
AGTCTGTAGGGCGGCGTCATTGAGCTGTGGACAGTCACTGAGATCCACGAGCACAAGTCTGCAGTTATGAGCCAGAAGACGGAGTCCCAGCTCTGTCACC
TTCTCACACTGAGCGAGGTAAATGGTGTCCAACTGTGCTTGGCAGTGTCTTGCCACAGCCCACAGCCCAGCATCCGTAATATGCGAGCAACCGGAGAGGT
TTAACCCGCGTAGATTTGGCACGGTGAGCACCACTTCTTGTAGCGTAGCGTCTGTGACAGTGATCCCCGTGTCAATTCCGTGCTGATGCAGGTCAATCAC
TTGCTGGAAGCGTCCGCTTTCGCCTGCAGCGAGGAAATTGCGCAGGAATGAGTGCATCTGTCGTTGTTGTTTCTCTTCCAGTGTCATGTTCGAAATCACA
GCAGGTGAACTAGGTCGTGGAGGCCTAATAGGTGGCAAGATCGACGTTGCAAGTCCCTTAGCTGGTGGGGGGCCCCGCGGTcgcttcgtcatcttctgAG
ATAACCCACTAGCAGTAGCATGGCTGGTATTCTGGTATCCAtcttcatgcagcagctccctggtacgtgctgcttcctctccAAAACTCTCCGGGTACGC
TTGAGGGTTAATTGTCATAGTCCACGGAATGAACAACGTTAGTCAGAAATAAATATTGTGCCCCATTTGGTCGTTACCACCGAGAAGCAACAAACTTCAG
TTCTTACAGAAAAATAGATCTCCCAGTCACCTCCTGAATAGGTATCTCGCCATCGAAGCGAAAGACTTTCTAGAGTTACCACAACGTTAATAGCTGGTGC
CAGAAGTGATCCTCCGGCGTGTATAGCGTGGAATACGCAGACAGGAGGGTCGAAGAGACGGAAAATAAGGGCAAGGCCAAGTCCGTGAACATCTTGTtca
cgtcctgcagcttcatgttgGTGAACGAGCTCATGCACAGAAGCAGTGGACCCCACGCCAGCCCCCTCCACTGCGATTTACACAGCATGAATTATTAAGA
GTAGGAAACGTGGTTCGAAATGTGTGTGGCGTACCTTCATGAGGAAAGCGAGGAAACCCAGCGCAAGCTGCAATGTAGACGAAGCTGTACCTGTCTTCTG
GGACCCCCAGCTGCTCACGAACGAACGGGTGCAAGTCGCTGGGGCGGCGCGGATCCAGAGTCGGCGGACTGGGACGCTGTTTGATATCGCATCGTCGACA
AGATACCACAATGAGAAACTGCCGGGAGACGTAACCTCACCATTCTTCAGTATCGTGTTGGTCAACCGCACATACTCCGCACAAACGCTTCACGCTGCTC
TTCCTTACAGCTCCCAATGGATATACGGATCAGCGTTAGTTCTCAATAGCTCACTTGGTCGTACctccaacagcaacaaagGAACAGGCAACAGACTTCA
TTATGTCCCTGTCAAACTTATGCGGTAGGCTGGTGGCCTCTTCCTATAGATCTTCTCTACGAAGCGGGGGCTTCGACCGTTTGGGCCGACGATGGCATGG
GCATTCCTGGACGCATAGCGCCCATGTAGGCAGACACGAGGgccgaagtggagaagaagaaggacatggCCACCTGCGTCGTGTTCATGTCCTGCGACTT
CATGTTGGTGAATGATCCCACGCACAGCAGTAGTGAGCCCCAggccagctccttccactgTGATTTACACCCACAAAAATAGGAATTAGTGCTAATTTCA
AGTAAGAAATACGCATAGAGCGACGTACCTTCATGGTGAAGGCGAGGAAGCCCAGCACGAGCGAGAGGAAGGCGTACCAGTCGCCTGGGGCCTCATCTGG
GTCCAGTTGCTCACGCACGAACGGGTGCAAGTCGCCGGGGCGGCGTGGGTCTCCCTGCAGAGTCTTAGTCGACATTCTGTTGTCTCTATCGCAAAAATTG
AGGGAATTGAAAAATGTATAGAATTTCGTAAAACTTTGTATTCAAAGCCAAAAATCTGCCACATAGTCAGATTTCAGACCTTGTTTTGCGCGGTGATACG
CAGTGTGGCCGAGTAGAAGCTGTCGATGTATTGGAGGAAGTCTGCGTTGGTCTCGGTATCGTTTCGGGGCTGTAGCAGGAGAGAAATAAGTGAGAAAGAG
GTGTTAACCCCTCTAGCCCCAAGCAATTCATAGTATGATTTTCATACCTGGTTGTTGACGCTCTCTCGTCGTCTGAGTAGCTTCTCGTCGTTTTGCAGCG
CCACTTCTTGGAGCTTGTGACGATGGCGAGTTTTTAAATTTGACAGTTCTAGGGAGTGCACAGCACGTACATTTTCGACTTCGGCGAGGTGTTTGGCCTC
GATGTCGCGTTGGTTTCgttcagcttcgtccagagTTTTCTTGTAGCCCTCGATAAGagcgcgcagctcctgggcagcacaagaagcagcagttaGAACA
GTTAATAAGAGAGAGGATCGCGATGAAGCACCTTGTTCTCGGCGGTTAGAGCCTCTGCCTCGTCCGATTTCGACTGTAATTTCTGGTGCATTTTGTCGAA
AGCTCCTTTCCAGACGCGCTGCCATTCCCATTGGTCGTCTTGCTCCTGGGTCTGGATCTGTTTACTCTCCTTCTGAACAACAGTTACAGTCCCAACATCT
TtggagttgttgctgcctcgTCGCTCTTTCTCTGAGTTGCAATGGGTCTGCTGCACTGGTCGAACTCTAACAAGCCGCTTCGATGCCTTCGCTAGTCGTG
CAACCTCATTCAACAAAGCAGAACACTCAACAAATTGCAAGCAAAGCTTCTCTTGTACGAGGTCTCACCTGATACCTCGGCAGTGCTGGCAACGGTCCTT
GTGGAGGCATTTTCGTGAACGGCTCCTCGGTCACCTTGAAACAGCAGCGAATTTAATATCTGTCGAGATTTTAGAGCGGTGAAAGAGCGTGTACTGTACG
TACACCTTCCACTAGCATTTGAAACAGAGCTTCGGCATATTCCAGCACACTCTTGAGCCACGTAGGATTCGACGTCGGTTGGCTGCGGAGCTTGCGCACC
CAGTGGAGAACTCGaatctgctggtgcttgttAGTGTTGCCTTCTTGAGACCCCTGGGCACAAAGATCCTGAATCTGAGCCAGCACAGCGTGCAGGTGTT
CAACAGAGTTGTTCGACACCGTGATGATCCCCATCGGTTAGCGAGGTGAAGAGTCGAGTTCTTGAGTGAAACGTTAACTGGAAATACCCCCAAAGAGCGA
AAGAGAGGAAAATGGACCATAAGGTCACAACCGACTACACCAGGTCACTCGGGAATGCGAACGTCAAGGTATGTTGCTGGTATCACGAAGAGGACGCTTA
GCTTGACTGACCCCTCTATTGCTTAGGTATATGTTCGTGCGAGGCCATGCGCTGACGGTCAGAGCGCCCCCGAGGACATGTTCGAGCGCAAAAAGGAGAC
CCCGAGCAATATCGTGATCAAAGTACGGAAAGTAAtgtcttcttgttgctgatGCTTTACTTATGTGAGCACATCACTAGGACACCGAACGAATGCAGTA
CGGGAACCacgccttcagcttcgacaatGTACTGTATACCGGCGAGCTAGTATGGATTGCACTATTCTAATAGGAAAATGTGTTTACGATAGATCTATTG
GACTGACACGACTCAAGAAACACTGTTCGAGGCGGTACCGAACTTGGCCACCTACAGATCACTAGTAATTCAAAGTGACTCATTAGGCTCACAAGGTGCG
CTGTCGTATTCTGCTTCAGACAAGCAAGAGCCTGGTGGATTACGCATTGAAAGGAATCAATAGTTGCTGCTTTGCGTACGGACAGACTGGCTCAGGGAAG
ACCTTTAGGTAAATCATTGGGGTTGGTAAACGGTGGAAGCAATCAAATGACGTAGCTCTGCTCACGTAAATGCAGCATATTTGGCGAACCAGGAGGAGAG
AAAGCAGGATTGCTGTCGCGGTCAATTGAATATCTCTTTGATATGGTAAATCGCCAGCAGAGCAAATCCAAGGTGCGTGAAGAGTTTTTGTTATTTTTTC
AAACGAGATATCGCTTACTGTTGATACGTTTTCTTAGGAGGTGACTCTCGTTATCAGTTTTCTGGAAATTTACTGTGATCGTGTGCGTGATCTCGCTCGA
GCGTACGTCGCTTTAGCTCAACAGCCTGCCCTACTGCTTTGCTAACGTTTACACGTGAACTTCATGCAGGTACCTCAAGAAAACTGGTCGACCAGTGTCG
TATCAGACGTCAAGCAGTGCCGAATGGTTCCTGCGCCAAGTACGTTTGTCTCCATTGGGACGTATTCGTATATCGTTGACAAAGCACTCTGCTACGGAAT
GTAttgaacagcaacagcagcaaatcCCTCGAACGGAGAGTGCCGCTAGGTACTGTACACGCTTGCTTCAACTACTCTTTACGTTTTAGTTGCCTCACCG
ACAGCTATTGTGTCTAGCTTCAGCTCGAATCCATCAAAAGCCGAAGAAGACTACGACTACGAAAAAGGTGCGATTTATTCCGAGACTCATCAGGTGCAAA
TTTACGGAGcacctacatgtacatttgCTATGCGTTCATAGCAAATTATGAGATTCATGAAGATGCTCAAGGGAGAGTTTTCGTCAAAGACCTCTCTATG
GTGACCGTAACATCGAGGGAAGAAGTGGATGCGATCATACAGTCCGGACTGAAACTGCGGTCTACGCACGAAACGAAAATGAACGCGGTGTCGTCACGTT
CGCACACAGTTTTCACAATTCACGTCTTCCAACAAGGTACTGTAGCCAATGGACCTACACCTCGACTAATTTAACAGTTATTTACTTGTTGTTTTGTAAT
GGCAAAGTTCGAGACACGGAAGAAGTAATCTATGGGATGCTAAACATGGTTGACCTCGCAGGGTGTGTACACAGATAAAATTTGGTTTTACCTTCTGGTA
TTCTGACACTAACGTTTCACTGATAGATCTGAGCGTCTGAAGAAGAGTGAGTCGGACGGCCAGCGGTTGAAGGAAGCGTTGCACATTAACTCGAGTTTGA
GCGCAGTGGGCAAAGTTGTGATGTCCCTGGATCCGGAGAGCGGGTACAACTACATTCCTTACCGCGACTCAAAGCTTACCAGACTCCTCCAGAACAGTAT
TGGTTCGTTACAGCACCTCAACTTGCAGGATGGCGCGCCACTGTCTCACCTGCTTGTCCTTATAGGTGGTAATTGCTTCACCACCCTCATTGCAACGATC
CACCCGATGAAAGAACACTATGAAGAATGCTTGGGGACTTTGCAATTTGCTAATCGGTGTCGATCGGTGCAGAACCAGGTAAGAATTTTTTTATATGGGA
ATGAAATGATAGTTGAATCAAAGCTAACGCAGCAGTTTGGCGTGTGTAGCCCCGTGTAAATCATATCAATGGGACTATTGCAGACAAAGATCGACGCATT
CGTAagcttcaagaagagctgaGCGTCTTGCGCCGGCAGCTTGAGGGGTTACGCGCTGAATACAACAACCGGTTTGTCACCACGCTGAACGAGCTCGGCT
TCCAGGCCGAAGAGATATCAGAAAACGGCGAAATCAAGTTTGCTGTACTGTGTTCAACCAGCTTAAGCTGATTTTTAAGTTGTTGATCGAGTATTTCTGT
CTGTAGGATGGTCTGGTGTTGAAGTCAGTGTTCTCAGATGAAGAACCAGGGGCCAATATCACGGCCTCCAGCGCGCTCTTGAAAAACAAGCATCTGGGGC
CTACTGGGCATGTGCAAAGCTTGCTCAGAGCGAACGGTGCGTTACCACAGCACTTAATCAGACTTTATCCGCTTGAATGCTGAAAATCCTGTCTTGTTTT
CCCAAAAACAGTGGAGGAGACTCGGAATGACCGAGACCGCTTACGGCAAAAATACGCCAACGCAAAAAACAATTTCACAGTAGTTGTGGTGCGTGCATGC
ATCTAGACCACTAGCGTCGTTGTTTTTGACCCGTTCAACACATTTGTGATGCTGTCGTTTTCAGACGGAAGCAAAAAAGGAAAAGGAGAACGCACGCTGT
GTAATAAACGATCTAAAGCGCAGAATTGCGACGCTGGAAAGCTGTTTACAGCAAAAATCGAGCGAATATGAGCGCGCTTTAGCGTCAGAAGCGGCTAGTC
ATAGAGCCGAaatgctggtgcttctgAGCCGAAACAGCCAGACAAGTATGGAGAGTCAGATGACGTACCAGCAGATCTCCACTTCGGGTATCAACCCTCA
CGTAGATACCAGTGAAGATCGTGAAAATCAGTTTGACCAGGTAggttactacatgtacgtagCCTCTGTTTGATAGTTATCCTGATGGGAGTTCTTCTTt
atctgcttcttgttcttcagaGATTACGTCAGCGTGTAGCAGCCTTGCAGAAAGCGAAAGAGAACGAGATCGCGCTCATCCGACAGCAGGTAATTGGGGA
AAATCTACCAGTCTAACGTTGATCGGATTCTAAAGACGACGCTACTGTAGTATGATCAATCTCTGAAGAACAAaacggaagagctgaacACTGCCAATAG
CAAACTGCAACGACTTGAGGAGACTACGACGGCTACTATGGATGTACGTTGAGTAAAGTGGTACGAATTGTGCCGATGCTAACTTCGAGTTATCGTAGAA
TATCCGTGAGGACTGCCTAGAGTTGTACACATACGTCGGACGGGTAGTAAGCGCTGCGGATGCCAGTCAGCGGTACGATGAGAACAATTGGCCCCCGGAG
TATACTGCGTGTACTTGGATTTAACTTTGTTATTCTATTCCACTAGAACATTTTCATTGCCGAAGAATATTCTGGCAGACCCAACGAAGTTGCGGCATAT
TAAAGCCATTGTACGTATTACTTGTTCTCACAAAAAACATCACCACTTGGATGTATTTCTTAATTAATTGTGGCGTGTTAGATGACAACAGTCGCAGCAC
GACTCCATTTGCAGCATCCACGCTCTGCTGCACCATTGCCATCAGCAATAAACCGAACCAAAGTGTCACGACCCCTATCAGCGCCAGTGCGGAGAACGAA
ACCCACAtatgcagcagctctacgtgACCGCGTGAACCGGCCACTCATTAACCAATTCACTTTCGACGATGAACACGAGGAGCACTCTGGCAACAAAAGC
GATGGACTTCGATCTAAATCAGCGACGCAGGAGCTACAGACCACTGACGGGGCTGAAGATGCAGCGGAGTGTCGGCGCCTGATGAGACTgttagaagaag
aagtaagGCTTCATGTTGTGCTTGGAAGCTTGAGCGAATTGATATCTCACGTGTTGTATCTTTCACGCAGCGTAAGAAGACTCGCGCTTTGAAAGCTGCT
AATGGCGCTCTTAGTCGTCAGAAGGAGTGCAACGGTTTGAGGAACGGAGGCACTATGTAGAGCATTTCTTTTGTAAAGAAATGACCCCTTCATGTTCTTC
TAAATCATGATCTAGGATGTAGCTGCATCAGTTGGCACTTTTGGCAATCTCCAACATCTCGATTACAGACGTGATCTTCTCGCGAGGCTTCCCAACAAGT
TCGCCTCGGCGATTCTCCTCAGCATTAAGGCGTTCATAATCAGCCCATCTAACGAGCTGCTTGTCTGGGTTGCGCTTTTtgatgatcttctccacagcct
ccagTCCACCCAAGACTTCATCGGCACTGTTGTCGCTGTGAAGGAAGTTGCCCGCTGCAAAGTCTTCCACGATGCAATTGACAGTTTCCCGAGCATCCAC
AATATTGGTACCAATGATGCCAGAGGGACCACGCTTCACCCAGCCGGTGCAATACAAGCCGACCACAGGCTGCTTCTCGCCGCTGCTTGCCGTGGTGATC
ACGCGCCCCTGATCATTCGAAACCACGTGACGATGGTTGTCAAAAGGAACATCTGACTCGATGGGCAGCGACTTGTAGCCAATGCTACGCAGCACAAGAT
TGCACGGAATATCCTCAAACTGCCCCGTTCCCACAGCACGCTGTCGGTTCGACTCGCCTTCAAGCTTCGTCTTTTCCACGCGGATAGCTCCAACTCGACT
CGgatccttctcgtccgcgAGGATTTCTGCCGGCGAGCTCAAGAACTTGATCTGCACCACACGCTTGGCGTCAGCACTGTCGAATTGCTCTGCGGCCTTG
ACCAGCAAGTCGTTCATGCGCTTGCGCGCGCGCTGTTCTTTGACTTCCTGCTCAGACGCAGGCGTCATGCTGTGCTTCAGATCGTCAGGGTCGACGACAC
ATGATACGCCGTTCAGCTTGGTCAGCTCTCGGATCTCCTTCATAGTGAACGCCGCTTGTGCACTGCCGCGCCGTCCCATGAGATAGACCttcttgatgct
gctgttgcgcaGTACCTCCACGGCGTGTGTAGCGATATCCGTGGCagccagctcgtccacgttctTGGTGAGGATGCGGGCACAGTCCACCGCCACATTG
CCCTGACCAATGACAACCGCCGTCTGCGTCTGTGTTaggtccagctccaggtcgCGGAAGGCCGGGTGGCCGTTGTACCAGTTCACGAACGTCCGCGCAG
ACATGACACCACGCAGTTTTTCCCCCTGGACGCCCAGTTCCCggtctcctgcagctccataGGCCAATACGATGGCGTGGTAGTTCTGTCGCAGCTCGGC
GAGCGTCACGTCCTCACCAACGCGCACGTTGCCCAGAAAGCGAAAGCGCTCGTCAGCCGCCACCTTGTCGAAGTCATTCATGACGCTCTTTACTTCCGGA
TGGTCGGGCGCCACGCCAGAGCGTACGAGGCCGAAGGGCGTGGGCAGAGCCTCCAGCATGTCCACACGTGCGCCGGCGTGCTCTTTTAGCAGGTATTTGG
TGGCGTAGAAGCCTGCGGGGCCTGATCCGACCACGCACACTCGTCGGTGAGGGGCATCAACAgcagagctgaagcttcgtGCGAGGCTGGCACTAAGCAC
GCGCTGGGAGCGGGTCAGCACTGACCGACGAAGCTGTAGGAACGCCATAATGGAAGTGAACCGGAGGAGCAGGTACCCGAGTCATCGACGCCATGAacaa
gagtgatggtcaaaGGGCGCAATCAATGGCAATCAAATCGGTTTTTAAGATATGCTATACAGTAGGTTTCTTGCATCATGGTATGCTTTACATAGGGATT
TAAAAACCGGTTATCTGGTGGTAAATCATTTCCGTTGCAGAAAACGACCTTCAAAAATGAGTTCACGAGCGCAAAGTTGTAGCGTTACGCAGAGAAGCTT
TTTGGTGAGAAACTTTCGCCACATGAAGGCACGCGCCGCAATTACAGCGGCCTTAAGGAGGCACGCAGCGATGGTTAGTGCGGCATGTTGGCTGTGACGC
CAGCACCGCGAGCCTTTACTAAAGTGCTTCGGTAGTCAAATCCTCTCGCGCGCCGTCCGTCAATCCCAGCCGGTTGCAACAGCTGCGCTGGCCGATCTAT
GTGGTTGCTGTATCAGGGTAGGCATACTAAATATAAGATAATTCAGTTGCTGATTGGCAACATGGCTCCATTTACCGGTTAAGTGCGGTATCTAATCCTC
CCCCTCTTGGCTCAAGTCGACCACATTCCCCTTTGGCAGACCTCGCGCGCACCTCCCTGAGTTGTAGAGAGAGGGACATCAAGACACCATGAGCGACCTG
CAGATGGTGGTGGGCGCCAAGTGCTTCGTGCCGGACGAGACCCACGTGTGGCTCGCGGCCGAAGTCCTGCGCGACGAGAACTCGGGCGACGGCAAGACCC
GCAAGATCTACTgcaaggtggagctgcctgACGGCGAGACTGAAGAGCGCTGCGTGGATATGCTGTCCAAGAAGACtaaggcgctgctggacgtgcacCA
GCTGGAGTCGTTGCCCTATCagaacgagaacgtgggCCCTGAAGGTATTGAGGATATGATCACGCTCAACTACCTGCACGAAGCCGCCATTCTGTTCAAT
ATCAAGAAGCGTTTCCTGTGCGAACTGccgtacacgtacacgggCGACATTTGCATCGCCATCAACCCGTACAAGTGGCTCCCGGATCTCTatgctgaag
agcagcaccTTCGCTACCTCAATCAGcccaaggaggagcttcCTCCGCACGTCTACGCCACGTCAGTGGCTGCTTACGACAATATGCGGCGCTCGGAACG
CAACCAGTCCATCCTGGTTAGTGGGGAATCTGGTGCTGGTAAAACAGAGACCACGAAGATCCTCATGAACCACTTGGCTACCATTGCCGGTGGTCTGAAC
AACTCTACTATTAAGAGGATTATCGAAGTGAACCCACTACTCGAGTCCTTCGGTAATGCTAAGACCGTCCGTAACGACAACTCCAGTCGATTCGGAAAAT
TTACACAGCTGCAATTCGACGCGAATGGCACGCTCGTCGGCGCCAAGTGCCGCACATacctgctggagaagacccGTGTGATCCAGCATGAAGCACCTGA
ACGCAACTACCACATCTTCTACCAGCTGCTGGACTCCTCTGAGATTGCGcctgagctgcagctcgaccCTTCTAAGCACTACGTTTACACGGGTGACAAC
ACGGCACAGAAGATTGAAGGCCTCTCAGACGAGAAACACTTCAACAAGACGCGCGAGGCGCTTGAGCTAGTGGGTCTGTCCCGCGACGATCAGAAACCGC
TGTTTGAGGTTCTGGCTGGTGTTCTTCACCTCGGTGAGGTGCAACTGCAGTCGGATCCGACTGATGACGAGAAGTCTCTCATCACCGAAGGCGACAGTGG
TGCGAACTCCGCGACACAGATGCTCGGCGTCACGTGGGAGGCGCTTCAAACCGCTCTCTGTTCGCGTACCATGCGTGCTGTGAACGACGTGTACAGCGTG
CCATTGAAGAAGGATTTGGCTATGGACTGCCGTGATGCTCTTTCCAAGGCCATCTACTCGAACGTCTTCGACTGGCTTGTGGAAACGATCAATCAGTCGC
TTGCTGACGATGCTCATATGGCCAACCACGTCGGTGTCCTTGATATCTTCGGtttcgagcacttcaagcacaacTCGTTTGAGCAGTTCTGTATTAACTA
CGCCAatgagaagctgcagcagaagttcacgcAGGATGTGTTCAAGACCGTGCAGATCGAGTACGAAGAGGAAGGTATCGTGTGGGACCACATTGAATAC
GCTGATAACCAGGATGTGCTGTCCGTGATTGAGTCGCGCATGGGTATCATTTcgctgctgaacgaagaGGTGATGCGACCGAAGGGTAGCGAGGAGTCCT
TCATGTCCAAGGTGACGTCCCTACACAAGGATGACATGGCACACGTCATTGAGTTCCCTCGTACGTCACGCACAGAATTCCTTATCAAGCATTATGCTGC
TCCTGTGATGTACGATTCGGTGGGTTTcctggagaagcacaaggaTTCGCTGCTGCCTGATCTGTCCGAACTCATGCGTGGTTCGTCTAAGCCGTTTATC
GCCAAGCTCTTCGAACCCAAGCCGGAGCccaaggctgctgctactgaggCGTCAGGCGGCCGCCGAAagcgtggtggtgctctgTCCATCACGACTGTCG
GTACCCAGTTTAAGGAGAGTCTGACCGAGCTGATGGCTACTATCAACTCGACCCGTGTGCACTATGTGCGATGCATCAAGCCCAACCCGATCAAGAGTGC
GACTGTCATGGATCAAAACATGGTGGTGTCCCAGTTGCGATGCGCTGGTGTGATCGAAGCTATTCGTATCTCTCGTGCAGCATACCCGAACCGATTGCAA
CACACGGAGATCCTGGATAAGTTCTGGCTGTTTGTGCCGAGTGGTGGCGAGTCTGCAGCAGACAAGTGCCAACTGCTCATggacaagctgaagctggaat
CCCCCACGCAGTACCAGATGGGTAAGACTCGCGTGTACTTCCAACTGGGTGTacttgaagagctcgaggacCGTCGTAAGAAGTTCCTGGATGCGAAGGC
CACCTATCTGCAGAACGTTATGGTTGGCTTCACGCAGCGTATCAAATACCTCCGACAACTGGAAGCAATCATCAAGTTGCAGTCAGTGATTCGGTGCGTA
ATTGCTATGCGCAGATACAACACGTTCCTGAAGGGCCTCATTTCAGCACAAGCACACTGGCGAGGCATGCAGGGCCGCAAGTTGGCTGCTGATGTCAAGA
GCAACCACAACGCTGTCATCATCCAGCGGTATGTGCGTGGATTTGTCAAGCGTCACCGTTACGTCAAGATGCGCGCGATGGTCATTCGCGTGCAGGCTGT
GGTGCGTATGACGATCCAGCGACCAAAATACTTGGCTGCtctcgaggagaagcgtcGTGAGGCGGACATGGCTTACCAATTGCATAAGCTGAAGGCTGct
ctgcaggaagagcaggagcggAAtgcacagctgcagcgtcgcagCAGTGTGGCGACGGCTGACTCGTCCGCTGCCTCGAGCGTGGTCATGGCTGACGCTG
GTGGTATGATTGAGACTCTCacggacgagaacaagaagctgcgtgagaagaacgaggacaTGAAGGTGACGATGAAGGGCTTGAAagcggagatcgagaa
gttcaagagTGACAAGGAGTTCTCGTCTGCTGGTAACCACGTCAAGGTCCGCCAGCTGCAGGACACTGTGCGtgacaaggacaagaagatctcgCATCTT
GAGGCCGaaaacaagaagctcacagagcagatcgccaagcTTCACGAGGACGGTGTTGTTcccgagaagaagcccacGCCGAAGAAGTCGATTTTCCGCA
CGCTGGGttccaagaaggagaagaagcctcGCGAGACTGTGCTGATGGACTCGCTTACCGGCTCGGATGACCTTAACCGTCGCTCTTCGGAAACCCGTCC
TTCGGAGCGCCACTTCCCGCGCATGCCGAGCATGAGCGTTGGCTCTCGCTTCTGGAACTCTAACAAAAAGGGCGACAACGGCGACGGCTTTGACGTCTCG
GAGGTTGACGGCGAAGATAGCCCCacgaacagctccaccacgcgcAACACGATCGTGAAGAGCATGGAAGTGGGTGTGACCGGTGCCATGTCGAGCCTGA
AGGGCCGCATGTCGGTCGTGAAGGGCATGTACGACAACCGGAGCAAGCGCACGAACAGCAAGCCTGAGGAGACCGCGAACCCGTCCGACAACGTTGCGTC
GACGACGGTTGTCACCTCGAAGAGCGCTAAGGTGAAGCCGGCAAAGGCTGATGACCGCCCCGTGCGCGAGTCGTTTAACCTAGATGCGTTGCCGGAGGTC
TCTCTGCCTGTCGGTTGGGAAGCGAAGGTGTCGCGCTCCACGGGCCGCGTGTACTACGTTAACCGCAAGCTCGGCAAGTCCCAGTTCGAACGCCCCACTT
TGGCGTCGCTGAAGgcgcagaagctggcgcgcCAGAAGTCGGGTAACGCGCTGTAAGTAGAAGAGACGCCGCGACAGCCAGCACGAACCCGCAGTTAGCG
TGCTGTCGCCTCGGCGCTTCGTGTTATCCCCATTAGTAGTAGTACGTTGTCTGGGCAGCTAGGAAAGATCCATAATAAACATATCAACCATGTTCCGTAC
GTGCTGATCCACAAGGCAAGGTATCGATCGCACTACAGGTAGTACATTTACCATATTGGACTGAGGACTGTTATTACGGAGAAACATGCATAATATACCA
CCTTCGgctggccttctcctcctccttcgtgctcttctGCCTGTCGGAAAAGCAGAGGTCAGGGAAGTCCGGTGGTTGCCAACCACTGGTTGGTGATCTG
TGTGGTCGAAGGACGCTGGACTTGACGGATGTAGCTGATTTTCAGCTGGACGAACTTCGCAGTTAAATATTGACAGGACGGGGTAGCTTCTCTCTTGAGG
TGCTGGATTTGGCTCGACGTTCTCAAAGCACCATGACAGGGGCTTGCTCCCGGTTCTTGCGGTACGGTCCGCTGTGCCGTCGGAAGTTGCCGTAATGCGA
GTGGGTCGAGAAGAGAAGACTCTTTTTCGAGTCGGTCGTGCCCTTGGCATATGACAGGATCGGCGGGCTGTCCTTGCTCATTCTAACACGTAGAGGCCCG
TCGGGACTGGTTTTTGTTGTGGGCGGGATCATATAGCTCGCAGCCTTCGTGAGGCCGTGAGCCACCATTTCCACCGTGGAAGATCGGCGCTGGCGAGGCA
CCGACATGCCTCTCGCTCGCTGCATCGTGTGGTTAAAGGCAGAGGAGAGTTTGCGACCGACAGGCAGTGGCGCAGgctcctcctcgacgtcgacgtcatT
CTCTGTCTCTGCGTTCTTGATGATCTCCGTCATGGACCGGCACTGCGAGCGCAGCGAcgtgagctcctcgcccacagtctcgagctcctgctccagcccC
TGCACCTTttcgttgccgtcgtcgcgctcggacgagagctccatcacctccttctccaggGTCGTGTTGGCGCTCAATAGCTCTTGAATCTCGCGTGCCA
GACGTTCATTCTCTGCGTGAATCTCCGCTGCGGACGCCAttcttggagctctccgACGTCCTTGTGGGATAGACCGAGGATGGCAAAATGGAGTCACGGT
GAGCGGAAGACAATTAATTGAAAAGCGAGATTGACTTGAAAATTGTATGAATGGAAAAGACGGAAGAGGATAGGGCAGCCCGTCCCTGCCACGCGATTGG
CTGACGAAAGGGCAAGGGCGGAACAAGGATTGCCACTTTTCGTTTCTTGGATGTGGCAGTTGCCACTAGAAAGAAAAgtatttattttttatttattttg
cACGCTGCCGCCAAACTCAACGCCAACTAAGCACTTAAAGTGGTTCTATTTTTTATGCGTATTGCATCTGCTTTGTTAATTAAAATATACTTCGGTTTAC
AACaggcttctccacctccggCCAGGAGCTCTAATATTTACATATGAAATTCATACATACGTACTATGAATCTGCTTTCAAGAACTTATTAATACCACGC
ACTCCACACTCCGCCTGCCTCTACAGCTTGTACTGTAGAATCTATCAGTGGGTAAAAGCTGGAAAAGTTGGAAAAACTGGTTAATGGCTCCAGAGCATAT
CAGACCCACAAATAGACCGTAAACAACTATCTGAAGTTGCCCATCTATAATAAATTCCCACAATTAGGATTTGCGCGAAACGACGCGAGCGACGCATCGA
AACCAGAGAGCAACAAGCCAACACGTCACTCCCGAGCTTTGTGCTCGCCACTAGCGTGCTAGACCACCACAAGCTCGACGCTTGCAACAAGACCACTTAT
GTCACAGTAACGCTGGCATTGGATTCGACGCGTGGGGCGACGGTGGCGTCCGCGTCTGCGCGAAGAGCGTTCGGGGCTCATCGCAATGATAGGCTTAGTC
GACGCCCACCGAGAGCCTCGCACGACACGCATCGTCTGGTTTGGATCGTTATTTCAATGGTGCCGTCagccaagtggaagctgcgtTTGAGGAGAGCAGG
CGAGCAGAGCTGGCAATCGGCAGAGACTCTGCATCAAACCGGCGACGAAGACACCTGATTGACATTGCACCAGAAACTGCCTGGGCAGCGGATGGTAGCC
GAGTCCCACGTGAGTCAACGCCGCAACAATGCAGCACATACGGACAAGGAGCATGACATAGGGAAGCTGAAGATGTCTGTAGAGGTGTGGCAGTTCCCCT
TTCATACTTGCTTCATGCATCTATATCATGTTTAACAGGATCACTCCAAACATAATTTATTAAATTCGACAGTATTGCAATACCGTATTCCTTTCGGACA
ACAtggaaggcgaaggcgacaGTCGCGTGCACTTCTCCGAGGTGAGCGACCCCTGGTCCAGCTCCCGGCACGTAgcggtgctgcaggcgctAGACGCTGT
CGAAAAGGTGCGTGTGTGCGCTTACCAACCGCGAATTTTCAACCCCAACGGGCTGTCTCCCGCGCGTATAAGGCTACCAATACCTTGCGTCTAACCTTTC
CCACGTTTTGATGGTATCTGATGCTAGAAACTGGTGACGGCGCTACGTACGGCAGCCACTGCCATGTCACTCATGGCTCCACGCGTGTCGTCCGAAGAGA
GCTCGTCACTGGCCTTCAACTCGGCGTGCACTGAGTTCTTGCAGCTGGTCAAGGAGATCCACACCGAGCTGGCCAACCACATCCACCTGGTATCGGACTA
CCGCACGTTCGCACGCAGCACCTACGGCGCCGAAAAGGACGTTGAGATCTGTCGCGAGAAGGTCAAGGTCGTGTccgagcagctgcagacgctttCGCGC
TTCCTAGAGGACCACTACGCGCCCGAGGAGAGCTAAAGAGGTTGAAACAGAGACCTACTGCGCGCAGGCTCGTCGTATTAATTCACGTAAATTGCTAGAT
TTCTGCAGAGTTGCTATTGCTACTGGTTATCGAGATGTGACGGAACTGGGCAAAgtgcttctggagctggatACGCAGGTGGTGTTCGCGTTCCGCTTCC
AAagtctccatctcctgggTCTCGTCGGTGTTCTCCCCCACTCGTGTCTGATCCTGTAGCTCCGGAACGTAGTCGCGTACCACCGTCTCCACATTGTACT
CAATTTCAGCGAGGATGTGATCAGCGCCAACCTGCTCTGACTGTTTTCTTGGTGAGAGCGGACGGTACCAACCACAGTGATAAAATTGGAGGACAAGTTG
GCTTTGATGGGTTTCATCGCCTATGAGGAACGCAGCTAGCATTTCTCCTTCGTCCCCTCGCTTGTCTTTCCAttccagaagctcttccattgaaacgctg
aagagctcAGCGATgaatggagctgctcccTAATAGGGACCGGGCATGGAGGAATACAATGTATGAATGCCCATCCTGGAATTGTCAAGGCTTTCATGCG
TACCCGGTAGTGGTGTGACAAGATGAATCGGATGCtgatagcagcagcgtgCCATTTCAGAGAGTGTGGTCGCTCAATAACGAGTACAAATGCTAGAGGA
GTCAGCAGACCAAACCGGTCGACCTGCTCCAGAAGGTAGCAATGAGTGATACAGGACTTTTGGTTTGGAGGAAACAACGTACCAGAATCGGCAACAGATT
ACGATTTGAGTTTATCAGAGTGTTGACAGCTTGGGATGTTCGAGCAAAAGCCGAGCGGAGGTGTACATACGTTTCATACTCGGTAGTATTTTCAATGGAG
GCAAAGCGCTCCTCAGCCTGGCTGGAATTAAAGCATACAACATCGTTAACGACGCCTTCAAAGCTTATGAGTACTAGAATTTCAGTAGGCCGTACGTATC
CAGCGTTTTGGCACTATCTCCGACCAAGTGAACGAGCTTGTCACAAATGACATCCTGTTACAGCACTTACTCAGTAAATATGCTACTTCGAAACACAAAA
CATTGGTGAACAAAACAGACCTGCAGTCTTTCCAACTGCAAAAGcgcatgaagcagctcaaggctttcgtgctggacgtAGACATCAGTCGATTCCAGGA
GAAAGAGGCATAGTGGAACGAGCTCGAACTCTTTCCGTCGTCGATACCCCGGGTCGAATGAAAATGAATTCTCTGAGATTAATTCCCGGAGTACCTTTAG
TAGCAAAACGGTTATCAGAGTGTGGTGGATAACGTCAAGACAAGCCAATTTACCTGTGCTCCAAAAAGTTGGAGACGCACTTCAGAATGCCTCAGCATGA
AAACAATGGCCTCGTGAGCCTGGTCGAGACAGTTTGAGTTACCTACAAGCTGCTCCAGAAGCACCTCCCGACAAAGAGTCCACACTCGAGACTCTGTTTT
CCAATCGTCGATGTCCCCACTTGCCAACACCCCGTGGATCACTGCTAGCTCACCGCCTAGACAGCTAATCTCCTCCTTGCACTGCCGACCCATCTTGGAA
ATCCGTAGGATGATGCGGAGCAAGGTCTCTCGGTCAGAAAGCGAAACCAGCGGTTTGTGACTTTGGGAGTCCTCCCCCTGTATGGTCAAGATCTTTAGCA
CCAACTGAAGACCATCCGCATGCTGGAACTCTCGATAATACGTGTGTACATTCCCCGACCCGAAGAAAACATGAAGACAAGCTACTTGCTCTGCCAGCGC
AAAACATTTTACTTTCCCCGACTTACTCATGGGGCTGCCGGCCTCTTCGCCATTGCAAACAGCGCTTGCAGTGGTTTTCTGCATCCATGACAAAAGACGC
GGCAAGAAGAGAGCAACGTCTGCACCGCACTCGTTCTCTAATAACCCACCGCCGTCTTGTGTCGGATCAAAGTAGCTACGAAACCATTCCAGAAGTTTCT
TCCGCTTGGTCTTCGAGGCTAAACGAACAGATAACCGAAGTGAGTACGCCATTGTATCCTTCCCATCGATCAGGCGTACATACCTTCGTCCCAGTCACGA
AGGAGCGTGCTCATCTTGCTTCTTGTGGTGAAAGGATGCCAGGTAACGACGCTTCCACAATAGACGCTATTTGCGAGGCAAGTACACGCCCCCTGCTCGC
GATACCCAAGTCTCGGGTTCTGGTCGATACAATGGATTAACCTCTCGTGGCGGGCTTGGACTGCGATCCTCAAAGGCGTTGTGAGTCCACGCTCGCTCCA
CTGAGCGCCTGCGACGAGACCGAGACGGTGGTGGACTACGACTGCGGTTTCGACTTCTGCTACGACTCCGAGAAGACCTTCGATGATAGTGCCGGCGGTG
GCCTCTACTGTTCGGGCTTGCTTCCTCGTGGCTTCGGCTGTGACGGCGTgaacgactgctgctgcatcggctacgacttcgacttctACGACGCGAGTGC
CAGTGCGAGCGTCTATCCCGCTCTTCATCGAGCTATCGCCAAACCAAATGAAAACGAGTAGTCACTATCTTCCACCTCACAAACACAAGGCATGTTTCGA
CCTCGCATCTACCAAACGTACCTGCGGACGGAAAGGGTCTTCTGGAGGTGGCGTGCCCTTTAAACGACCTTGAAGGCTCGGCGATCTCGACCTATCGCTG
CTCTTGTCACGACGGTGCTTGTGTCTCTTGTGCTTGtgtttcttctcctgtttcttcccctccttcttctccgtcttggacATCTTGCGCCGCTTCTCCT
CGACCACATCGCGACCGAATTCGTCTTTCCGCGTTGCCTTCGTTTCCACAGGACGGTGATCTGCTGAGGTCGACGAAAAGAGTTCTATCTCTCCCGATCC
ACTGACGGGCGACGATACTTTGCTGTTATCGCTATGGAAACCCGTTGCACTTGCTGCCAAAGATTCTTGGGCTTTGTCTCTAACATCGTCTGCTGATACT
TTGGGCTGGACAATCTCGCCACTGCAATCaatacacacacacaaagACAGAGATTTCATCCAAATAGTTGCAACACTCAGATTAGCACGTGAACACCACG
CGTAGAGCGGGCAGGCGAAGACACGCACCGCCAGTTCCGCAGGCCACCGCCGCTCATGTGAATGAAATTTTGTTATTTGATCCCGTCCAAATCACAAATC
TTTCGTACTTAGTCGCACTCCACAGCACCACGGTCGCTCCCCCCACACTCAAAAGAAGGAGCAACCACCAGAGCAAGAGCCACCACCAAGCGAGCACAAG
GAGCGACGGCCGCCATgagcagccccagcaatgacgacgacttcgtcACCATAACCACCAAGCACCGCAAGAAACAACAGGTCGGAGATGCCGCCAGCAA
GAAGCCTCCCACGGGGGCCAACAACGGCGCCACTAGCAGCAACATCTCGCTGAGACCGCGCACAATGTTCGCCATGAAAGGCCGAGGCCGCACCGAGTCC
GAAGGATCCGCCTACCGCCCACAATGGTCCAAGGACGGCGAGGGCTTCGTGTCGTCAGCCTCGGGCGGCCCCACGTCCTTCAAAGACGCGGCCACAAGCG
GCGGACAGGGCGACGACCAGCGAGGCGAGCGCCGCAAGAGCAAAGTACTGCGTTActccaaggaggagctcttAGCGCTGCATTTCACAACCAGCGAGGC
GCCCGCGTTCCCTCCTGAGACTTCAGTGGCCTCTGAGCACAGCCTCCCACCCGTTAGCACGCTGCCTTTTGACTACGAAGAGATCTACAAGCAATGGTCG
CTCAACCGCAATCGTGGACGTGGCCGTGGACGCGGCAATGCGCAGCAGGGAGAACAGGGGCGACGTGGGCATCAGGAGagaggagctcgaggagacGAGG
CGGACGGATCCAAGCAGAGAGACGAGCACCACCGACACAACGAGCGAGACCCGACATGGGAGCGTGGCGCGAGAGTCACGGAAGGAAATGACGTCTggga
cgacgtgctggaacCTGGAGCGGATAGCAATGAAATGGTGCGACAATGTGGAGCAAGCTGGAAAAGTATCTTGATGACCAGAAGGCTGATAAGTGTAAAT
TGTGCATTTTCCAGGACCTGTCAAGTATGGCGGAGGCTGCGGAGAAGTTCCGACGAGAGATGGATGCGATGCGAGAGGAGCTTCAGGGCCCGAAGGTCGA
CTCGGTAcggcaaaaaaaaaataacttGGAGGATACAAAAATTAGCAGAAAACTAAGCGATTGCGTTATATGATTGAACAGGAGGTGATTAAGGATGATT
TGGACGCGTTCGACAAGAAACTGGAAGATGCCGCGGCTGCTGGACAATTTGATGACAGCGACAATGAAGACGTGCAATGGGACGACCCTGTTCCGGAGGA
GCAGCACAACACCGGCAGTGCTAACAGTCCATTGAAAGACCACGCCGCGGACTTGTTGGGCCGTCAGTCAAGTGGAAGCCACTTATTTGATGCGCTGGAG
CCGGCTGGCGAACAGCTCGCGCTTGAAGAGAAGAGTAGATTGTCCCTACCCCAAATGCAGGCCGACGAGGGTTTCGGAGGGCTGTCGTCGCTTCGaatgg
aagtggaggatGAGTGGTTTTACTTGGACCCCCAGGGGCTGCAGCAGGGACCATTTAAGACAGCAGAAATGCGCGAATGGTTTGAGGCGGGGTACTTCAA
GCCGCATCTGCCGATTCGCTTTGGTCGCGAGGGCATTTTTACGGCCTTAGCGAACCAGTTTGCACCCGGACAGCTGCCTTTCGCTGCACCCCCAGCGCGA
ATGAGCGGTCTTGGAGGAATGCCAATTGACCCTCGCCAGGCTGAGCAACAGCGCATGCTTGAGttgcagcgcgagcagcagcgtcaacagcagcaacaac
agcaaatgatgcaactccagcagcagcagcaacagcagcggatgATGCAACTGAACCAAGAAGAGAAGATTCGCATGGAGATGCAACGTCTCGAAATCGC
CcgtcaacaacaacaaacgCAGTTgtaccagcaacagcagatgctccagcatcaacaagagcaacaacgacagcagcagcagcaacagcagcagcagcaa
caacaaatgCTCCTGCAACAGCAAAGTTCGTGGCAGCGCAGCCAGCGCGAAGGTATCATGAGCGCTCTCGGCATCTTTGGAGGAAACCAAGAACCCAACC
TGGCAGAAAACGACAACTTCAGATCGGATGACATGCAAATTCAGTTCCAATCTGACTACCGTACGCAGCATCAGCGTAATCTGCACAGCCAACCTCAGCC
CGTTAACCAAGACTCGATGTTCCTCAATGATGACGTCCAGAGGCGCGATCAAGCGTTTTGGCCGAATTCCACGCCAGAAATGTCTGGTCTAGAGACAATT
ACTagtccaccagcaccggaATCGACTCAACCTCCTGCACCACGAAGTCCACCCGCCGCTCCAGCATGGGGAAGTAGACCGAAGTCCCCCGAGCGCCCGT
CACCCACGCTTCACGATATTCAGAACGAAGAGAagcgacgcgctgctgtcgaagctcGCAAAGAAGGCCACAATGTTACACAGCAGTCGCCAGCCAAGGA
AGCATCTCCTGTTAAatcggccaagaaggagatcaaggcTAGTGGttccgaggagaagaagagcccAAGCCCATCGAAAAAGAACGGCAAAAAGGCAGAA
CATGTTAAGGCTGAGACGAATGCTTGGGCTACTAGTGCGGCAGCCGCTACTACATCGAGCAACTCCAAGTCTCTCAAGGATATTCAACAggaagaacgac
gtgaaATGCTGAACAAAATgagtgatgacgacgacagcaactcCAATCTTGCGCACATGGGAGCGcagctgaagatgatgctgggCGTGGCGTCGACGGT
GGTAGCTCCGAATGCTCCAGCAGAACCTGCTCCAGCCTCGGTAGCTAAGCCAGCTCCAACCTCTGCACCAACTCCAGCTCCCCCCGCAGCAAGTCCCTGG
GGCGCACCCGCGGCAGTGACGAAGGCCTCAACCTCAAAGTCTATGCGTGATATtttggaagaagaggagcgtCTAGCGCATGAGCGCGCCAAGGCCAATG
AGAACGCACCTACCAGCTCACACTGGATGAACATCGTAGCGGGAAACAAGGTAGCGGCCGCAGCAATCCCCAAGCCATCTCGGTCAGTATTGGGCCCTGT
TCCCGCGTCCGTACTGAAGAGCCGTCAGCAGGTTCGTGCCGCCAATGGTGCCGCAAAGCCTTCCCCTCCCAAGGCTGAGAGCGACGCGTCCTTCTGGAAC
TTTGGAGCAGCCCAGGCTACCGGTGGTGCGTCCGACAGTACTCAGGTGTCTGCCTCGAACGCGTTTGGCTCCAGCAATGTGTCTTCGGAGTTTATGACAT
GGGCactgaagcagctgaaaACTATCGATagcaacgccaacgtgaCGTTACTGGAGTACTGCGCGTCGGTTGAAGACCCCGGTGAGATTCGGGAGTACCT
TGCGGCGTATCTGGGTTCAACCCCGCGTGTGTCAGCGTTTGCCACTGAGTTCAtccagaggaagaagacccAACACAGTGGTAAGAAGTCCCCAGGCCAC
CAAGACGCCCAGCAGCGTGCATCCGAGACGGGATCCTCGAACAAGAGAGGTAAACGCCGCTCCAAGGGCCAAAAGGTTGATCCGTCACTGCTGTTTGGCA
ATTAAGTGCTGACATTGAGTGCACGAAGCAGTGGCGAGCTAGTGAGTCAGTCGCGTGGTAGGAAACAAGCTGGACAGCACGTGCAGCAAGCATAGGAATC
AAACACGGAATTGTGGTCAAGAATCTTGTTGACTCAAGACGGAAAtggcttcatctccgacGTGTGGTACAGTGTTCCAATCGTACCTAATCGGGATGCA
GTTTACAAACATTGGGGAGGAAGAAACAGAATATTATAACCGGCAGACCCAGGACGGCTAAGAGCTACGATTGCGTCGTGATGGAtgaggagatgaagag
cgcGACGACGACAGAGGTGGTGCCGGCTGCGGCCTCCAGTGAGGAGAAGCGCTTTGAGATCAAGAAGTGGAACGCTGTGGCGCTCTGGTCCTGGGGTGAG
ATGCTATCTCCACTAGCCAATCGAGATCTTTTAGTGAACTAAATGGTCTGTTTCCTTATTTCTTTGTTGCACAGATATCGTGGTGGATAATTGCGCCATC
TGCCGTAACCACATCATGGATCTGTGCATCGAGTGCCAGGCAAACCAAGCTTCGGCCACCAGCGAGGAGTGCACCGTGGCTTGGGGCGTCTGCAGTACGT
CGAATTGGGTTGATAGCATTTTTATACCTTACTAATTCTGCTGTATTATTTACTACAGACCACGCATTCCACTTCCACTGTATCTCGCGATGGCTCAAGA
CCCGTCAAGTGTGTCCGCTGGACAACCGCGAATGGGAGTTCCAGAAGTACGGCAGATAATTGAGGAGGGCGATGGAGTGATCTGGACTGCAGTGCATTTA
CTTGCTAGAAGCAGACTGTGCTGAAGCATTGAAGACTCCTGATTGGTGGTGTGCTACGATACTCTTGAAAGAGAACAGCGGGATTCCGATTTGTGGTTTA
GTTACTTCAGTACGTTCCTTTCTCTCATTAACTTCTCTTACTAACGTTTTATCAGCAAATTCTGAATTTTACGGCGTATCGGTTTACGGGCTATTGAATG
CCTAACGATCGAGGCTTTCTTGTCTTCGAGAATACATAAGTTCAAAATGTTTTATGTCCACAGGGAGAGGACGCCCATGGCGCCATAGCCGGCGAGCAGA
GCAGAGCACTTCTCAAACTGATAGCGCgggtcctgcagctcctgtggGATGATCTCCATGATGGCAACGAACAAGAAGGTGCCACCAGCGAAGGCGGCAC
AGACACCACCTGCAGGCGTCGCGTGATTGGTATCGACGAGGAGCCGACCGAAAAGGATGCCCACAGGTGTCATGAGTGAGAACACTGCGACAGAGGACAG
GAGCTGCTTCCGCGATACATTGTGGTGCAAGAACTCCAGTGCCAGCGCGAATGCTGCCAGCGACTTGTGAGCCAGAATGGCAACGAGGATGTCCCAGGCC
GGGGAGCTCGAGGCTCCCATTCCCATGCCTTCCATCACGGAGTGGAACGACAGAGCGATGAACACGACAAGCGCTAGGATGGGGTTACCCTTGACGATGC
CGTGGATGTGCGAGTGCGGCTCCTCCTTTCCGCCTTCACCGTGCTCAGTAAGCTCAGTCTCCTCTCCTTGAGTTCCGTAGTCTCCAGTCTCCAGCTGGCC
ATGTGCGTGGCTGTGAGCGTGGCCGTGCGAGTGTCCGTTAGTCTTGGCCAGGTTGTCCACTTCGGCGGCACGCGTGACCTCGATCGCGAGCAGCGCGTCG
CGCTCCTGCTCTGTGCCATGGGCGTGTCCGTGTCCGTGCACCTTGCCGTAGTGCCGCTGGAGCGTGTGTGCGAGCACCTCAATGAGCAACACCATGAGGA
AGCCGCAGCCATAGAAGAAGTTGGCCCACTTGAAGCAGCGCTTGTTGTCACCTTGGTAGCGCGTGCGCACGGCCAAAAACACCTCAGCGGTGTGCTCGCA
GCCCCACTCGGTGAGTGCCTCGTTGTTCTGCGCGTCCGGCAGTAGGTGCATGCACGAGCTGGCGAGGAAGATGCCGGCCGCTACCATGTTAAGAACGCTG
CTGGCTCGCTTGCTCACGCGCTGGCTGCTCAGCAACGGCGCAATGCCGCCcacgagcgccagcaccCAGATGAAGAGGGCGGCCGCCAACTTGAATTCGT
CCACAGGGTCCATCGCTTGTCGAGAGGTTGCAGCGCTTCTCCCGTGTAATCAGTAGTCGGCGTCTTTCGTGCGGATGAGGAAATCGCAgagtgaagagct
gcgtgtGCAGCGCTGGGGTTCCTCGTGGGTCTGGTAGCTTTCTGAACGCGCACATCACGGCCGATTTCCGCCTTATCCGACGGCGGACCATGAGGAGTAT
GCGACGTGTGAGAAACCTGTTTACTTTGATGTCTTTCAAATATGCTTACATATTACATATGCAAGTCAAACATTTTTACAAATAGAAAAGTTGGCAACGG
CACAATTGTAATATTGTGTTTAAGAGGTTATTACCATAAGGAAAGCGAGGTTGTCCGAAGGCGGCGCGCTTGGTCACCAAACGATCGGTATGGGCGGACG
AGGTACGTAGGGCCTTGCCTTGTTTGTTTCCAGCGACGGTGGAGCGCCAGCGATAGAGTTATCAGCGATGACTGCGCGTTGCATCCGATTAATGATGTGT
TGCTATCTCAGCGTCCAGCCGGGGAAGGCacgcgtctgcagcgcagTCTACGGGGTCATCGGATTCACCTTCTGCAGACAAGATCAAGGTGGTCGTACTG
GGCGAGGCAGCCGcgggcaagacgacgctctTCAGGCGCTGGGTGGGGACTCCACTCGACGCTGACTACTTACCGTCCACTACAGGTGAGCAAGCAGTGA
GCAATGCATCCAGCGATAGTTAGGGCTAACGACAACTCGTCGATGGTGCAATGCCGCGTAGCCAGCTTAGGTGTCAAGTTGCTTCGACTGGAGGGACGCG
ACCCAGTTGTTGTCGAGGTGAGTCATccatatacatgtactaccgTAGTACTAAGTGGCGACTTGCTTTGTGTGTTGACACGCTCGTGTCTGCAGCTCTG
GGACGTGCCATCGCAGAGCTACGCAGGACCAAAAATCTTCTCTCGCTACTTGCGCGGAGCTCATGCGATCGTGCTTGTCTTCAATCTGCAGAGCCCTTTG
TCCTGGAAAGCGCTTCCCAAGTATCTCGACGTTGCCCGCCGAGAGGTGTCAGTCGAGGCTCCTTCCTCAAAGCCGTTACCAGTTGTGGTGGTAGGCAACA
AGAGTGACATTACAGCACAAGACGCTCAAAACGAGCAAGACGCTGTCCGGGCATGGTGCAATGAGCGCAGCATAAACTACGTCGAGGTGTCAGCACTCGC
TGGCGATTCGACCGCAGTGCTCAACGTCCTCAAGCTTGTCTGTTGTAACGTCTAAAGTACCTTCCAACCCACCAATCAAATAGTTTCACTTTTGGCAATA
TTTCGGTTCCTTAATCGCAATATTGTCTTTTTGAGTAGCTCCCCAACCAACGCAAAGATGTCGGACGAGCAGACGCGCACCATGGAGACACCGAgtctgg
agctcaagcagctggGCCGCGAGACCAAGAACCTTaagcacaagcacaagagcaagcgcgGGGGGAAAGGTGAcgccgcttccagctccaaggGAGCAGA
ACTCAAGCGTTCGCCGTCGTCCGCAGCGTCTCCCGGCCGCCATCACGTGCACTCCAAACGCAACACGAAGGTCAATCGGGAGGACGCACTGCGGGAGATG
CTGGCTGGGAAGATCGCGGAGATCGAAGTGGGAGGAGACGAGAATCTGGAGGCCCCCATCGATTTGTCGGGCATTTACCAGGACGAGACGTTGTCATCGC
AGCTGAAGGTTAAGGCAGAGACTCTAAAGGGGAACGAGGACCTGTCCAatgacgagaaggtggctgCGCTAGTCAGTGGTATTGGCCAGGCGGTAAGTAT
GCAGCTAAAAGAGGTGGAACTGGTGTTGGAGACTGACGAGAGCGATTAAATGACtgcagagcgagcagctggaacttatgcagaagaagatcggAGAGCT
GAACGCCAAGTGCATTCTACTCAAACAACGCAAGAGTGCAGGTATGTGTGAGggtttgctgctgaagtgaTTAGTTGCTTTTGCTAAAGTGAAATGTTGG
TGGTACAGTGAGtacggagctggtgaagaccaactcgtcgaagagcaagctggagcagctctgTCGggaactgcagaagcagaatAAACTCATTGTGGTG
TGTTTCGGAAGAAGTGCAGATCCGTCGTAGAGTTTTGGCTGACGTGTGTGTTATTCTTGTGCAGAGCGAGAGTCGTCGTATCGCCGATGAAGAGGACCAA
AAGAGGTATGGACTTCTGTGGTCATAAAAGGCGGTGACTTGTTCTCTTTAGTGTTTAAATACCTCTTTGCGCTTGCTTGTAGACGCGACCTCTCTGCCCA
GTTCCAGAAAACGATCGAAGAAGTGAGTGCGAAAATGGATAAGCAAGGCCAAGACTATGTGGCTTCGTTgaaagagaacgagaagtACGTCTACCATCGG
TTATGTATGTTGCAACCAAACTCACGCTCTCTGCTGTTAAAATGTACAGTCTCCAGCAAAAACTGAAGACATTCCTGGAGCAATACACTGCACGTGAGGA
GCATTTCCAACGGCAATTGGAGGCGAAGGATCTGACGGTTCAACTAGCGGAAACAAAGCTCCAACACCAAGTAGAGCTCACCACTCGCGAGgcggagaag
gtgaagatcACTCTTGACAAGGCAAAGGAGTTTTCGGATCGTGAAGTTCAGTTGCAGGCCCAGCTCAATTCCTACTCGGAGAAGTTTGATGTCGTGCAGG
AAACGCTAACGAAGAGCAATCAAATGTTCACCACCTTCCGCGAAGAGATGGACAAGATGGCaaaaacgacgaagaagctaGAGAAGGAGAACCTGGCGCT
AAGGAAGAAGTGTGCTGAGTATGACAGCGGGGCCATTGCTTCTATCCAAGAGAAGGTGACGTCTGCTGAGGAAACGATCAAACTGCAagagaaggtcaag
aagcTAGAAAGTCTCTGTCGCCACCTTCAAGCGGAGCGCAATAGTATCCGACAGGCCCAGCAAGTCCAAaccactgcagctgctgccactgagTCGGCTT
GAGAGATCCGGTCTACAGTAAAGCACTTGTGTACATGCACGCAGAGCAAATTTAGCGAAGATTGTCGACGGTAATAGATCCTGTCTCTAAATAATGCTGC
TCTGCCTGATCTATTTTCTTGTGTACCAGGCTACCACCAGCAAAGGCAAAGACGATGAAATCTGCTTCAAGTAACGAGAGTGCGTCGAATGCTCCAGTAA
TGAGCTTTACGCACGCAGCAAAGCGCATCGGCGGCAAAGATGCACCAGTCAACTATTCCTTCGAGGAGCGTGTGTTCTGTCCAGGCGATACTGCGTGTGA
CAAGGCGGCAGCAAAGttggagatcgtggacatGCTTCGTTCGCGGATTCTTTCGTCGGAGAAGCCGCAATGGGATCAATCAACTTCCAACTGGGACAAC
ATGCAGATGACTGGCAAGTGCTACAAGCGAACCAACGTCCACGCAGAGGTAACACGTCTCtctttcctgctgctggtcgatCCGTGGAACTAACCTCATC
ACTTTGCAGCGGAATCGTGCACACATGTTCGCGTACAACTTTCGGGCCGAGAAGCTTCCTAAGAAGAACCCGACGCTCAAACCGAAAACGAACCGCTTCA
ACACTGGTATCCTGGAAGTGGCTCTCAAGGACGAGTATGCAGGTGAAGCGTTCGGGAACGAACGCGTGATGAAAGTATGTTCGCTGACGTGCCTTAAAAA
GCATAGGCATCTGATAAGTTACTGTTTTTAAATAGGGAATCGCCAAGTGCACGGAGGAGCTGCCCAACCATCCGAACCTGTACGATGCCAAGCCCTGGAA
CCAGTCGGTTGAGCTAACCAAGATAGTTCGGAAGGAGCATGTATGTGGAGTTTGCTTCAGTATACTGTATTCACTGGATTGCGAACTAATGAACTCATTT
TTTTCAGTTTGTAGCACTGGAGTCTGCGCGACAGACCAACAGCGACAAGTGGCGGCACAAAGTcggcgagaagagcaactACAAGAGCCCGGAGCAGCTC
TCGAAAGAGATCTCGGAGCGTAAAcgtctggagaagcaggagcttgtAGCTGCCAAAACTAACCAGCGCCACTAAATGCTGACTATCAATCACGTTTTCC
ACGTTGCTATTGTGCTCAACGGACGCGACGGTTGCTAGTCGACGCAGTTCCTAACGCAGTTAGTTTGCTTTAAGATGGCGACACCGACGCCTCCGGAATC
GCTTGTGCAGTACGGTGAGCCGATCTTCACGGGCGAAACACTAGACCCGCCAAAGAGGGCCCCGGGGGTTGTGAACGCAGGATCTTCCTCCAACTCAATC
ACCGCCGCAACTGTCGTCGCAGCGTCGGAATCTACTGGGTCGCCCGCCAGCAAAGGCTCCGATGGAGTTGCGCGAGTTGAAGATATTCTAAATGCCGTTC
TACCTCCGCAGTAGGCTACCATACTTTCATTTGTTGTGGTACTGATGATCTATTAACCTTTGTCTCTGCGGCTAGGATGTGGTCCGAGGAAAATTCAGGT
TTCTGGCTTCGATACGCATCCAGCGTGCCCTCGACTCGCTTCGATGTACTGAAATtgcaggaagctcttgatGCCAAATTACTGCAGCGACAGGCTCGTG
AAAGCGGCATTTGCCCCGTTCGAGAGGATCTTTACGCCCAAGCTTTCGATGAGCTCATCCGGGAAGTGACATTGAACTGTCCCGAGCGAGGGCTTTTGCT
ACTGCGTGTGCGTGATGAGCTTCGCCTCACGACGGATGCCTACAAGACGCTCTACGACTCGAGTCTGACGTTTGGGGTACGGAAGCAACTGCAGGCTGAA
GACGGCATGGGCGACTTGGCCGAGCATATCGCTAGTCTTCAAcgtgagaaggaggagaacgagagcAAAGTGGCTGAGCTCACCAACAAGCTCGAGGTCA
TTGAGAAACGAGCAGCGGAACggaaggcgctgcaggagaagaagttcaaggaGGAGCTCGACTTCCTCAAGTATCAAGGCCAACACCTCGATGCCTTCCT
CAAGtctgctggaggtggcacCACTGGTGTTTCTGCGTCGAAATAAGGAGGTAGTAGTGTACTACACGACTTGGAAACAAAAGTTCGATATTGATAAGCC
CTTCTCGATCAGCACCTTGCACTACCTCGTACGTAGCCTTAGGCATCTTCCGCTGGCTCTGTCTTCGGTTGACTCATACCAGTCGCCATTTCAGTGAGAA
GCGCGTGTGCTGCAGTCAGATACTTCCTCTGCTCCTGCGCCACTTGACGACGCACATGCTGTCGCTGAGCGTGAGGCAGCAGGAAACTTGCTACCAGCTC
GCGCACTACCGTTTCGTCGCtgtccagttcttcttcaagctgcagtacAATCCCGTCCACACCAGCGCTGCGTACGTGCAGTTCATGCAGCGCTTGGGCA
TGAGACTGCTCCAGAAcaacctcctccagcacatcgtccacgaagtcgcGCGACGTCTCTTCATGCACGTGCATCACACGTCGGAAGACCTCGTCCTCAC
GCTCCCGTAACAAATCCTCCGCTTGCCGTCGCCCGCCTTCCTCTACTTCGCGTACACGCCGCTGTTCGTCCGCCTTGGTCACGAACGCACGCATTTTAGC
CACTTCACGAGACCGAGAGAGCTCTTTGGACAGGAAATCGAGCATTTCCGAGACTACTTCACCCTCCACTCgcgtcttcgctgcagtTTCCACACGATCG
ATTCCTTCAGTGCCAGATCCCTGCAGGAGTTCGAACTCgtggcgacgctgcagtgccAGTTGCTCGTCGGCCGCACGGAGTTCGGCGATAAGCTCAGCAC
GTCTCTCTTTCCCTTCAAACATCATGTTTTGAACAGCACGGCCACGTAACAGCTTCTGTAGTAGGCGCACGGCACCCTCCAGTTCGTGTTCATGCGAGTC
TGCGACGTGAGCAAGAGCGTAGTCTGGTGTGGGAGGgcggacaagctgctgttgtttctGACTAGACCGTCGTGTAAGTGGACTGCTCGTACTCTGCCGA
GATTGACCATCAGTGTCGTTCTGttccttgttcttcttgatgatggACTCCATCTTCAGTAGGTGAGCTTCGATTGCTGCTTGCTTCCGCTCCTTAGCCG
TACGCCCACTCTTCTCGCGAGGCTTGTACTTGCCCGCAGCAGGTAGTAACATTCGTGCTGGAACGGCACTTTCAAGCTCACGTAGCGCATCCAGTTGTAG
GAACTGGGGCTTACCGATACCCAGTTCACGAACATCCGTTTTGCCAGCTTTGCCATCACGCGTGACAGGGGCGTACACTTGTGAGCCGAAGTTGGCGTAC
TCAGCGATGATGTCACGCCCCCGTTCGGGTTTGGATGCGCCAAATCCGCGCTCCTGCTGTCTCTGAgctcgcttcttcgtcaacttACGCAGCGCTGCCA
CACGCTCTTGTTGAATCGCTTCAAGAGCATTCTCCTTttcatgcagcagccgctggCGAACCGCTTCAAGCCGTTGCTCGGAGAGAAAcgcgttctcctt
ctcgcgctctGCAAGTGCTTGTTCCAGCAAAGCTACTCGTTGATCATGGAAAGCGTCGATCTCGGCTTCGCGGAACGCCCACTCGCGGgtttcttgagct
tccagcaTGGCCTTACGCAGCAGGAAGCTGGCTTCGTCAGTCATGGGCGGCAGTGACGCCTCAAACGCACGCTTCTTCCGGTTGCGCTCGATGAGTTCCA
GTTCAGCCTGCCCAACTGGTAGCTGTCCTCGAGCATGGCTTAGTCCAGTAAGTGTTGCTATCTCGGGTGTCACTCCGGTCGCAGTCTTCTGGACGGTGTA
GTCGGGCGTGTACGGATCGGTTTGCGCCTCCGAGTCCCGATAAGCTGTTTGGATACCCACCGATCGCGTGCTCCCGTCGACTAGCGAAGCAGCGACGTAG
TTGGAGGTCGAAGCCTTCACATCCCGATGCTTGACTGGAGAACTTGAGGCTGCGTAAGCTGGAGCTAATAACACTTCAGGTGGCTCCGCTTGTAAGTGAG
GCAGCACTGGTCTTCGATGAAACTTGACTCGTTCACTACCACTGACGAGGTGGCTGCCCTCTGCTGGGTTCTGATTGTTGAGAGTGCTGCTTGTATTCGC
AGGCTTTGAAGATGCTCGGTACACCCCTTTGCGGAAAGAGCCGCCTGAATTCGACACAGTATACACGGTATCTGCGGAGAGAGAGACGTCAGCTACAGCA
CCACAGACGCACCAGGACGACTAGAGACTCACCATAGACGGGATCCAGTGCCCGGGATGGTGCTGTCCGCGACATAATGCCCGAGAACGCGCCTACAGCT
TTACCAGATCGACCAGTCGCGATTTCGGGGCCGAATACACACTAAAAAACCGTTTCCATCGCAGTAAAGAATAGCTTTTCGtgagcaggaacagcagtgC
CTTGTTCATTTTCACAGCAGTACTCACGCCACACTAGGCGCACAGTCGTGTAACGCCAGAACGTGCACTTGCACTACTCTGTCTTGCCGGTCTACGACGA
CACGCTCTTGGCGAACTGGAGCGCGAGTTTCTTGGAGTGGGTCACGCAGTCAGCCAGCCCGATGCCGTAGAAGCTGTTGCCGCCCAGGAACAGACCCGGA
GCGCTGCGAGCCGCCTGCTTTTCAATccgctgcagcgtctgaGCAAAACCCACGTGGTATTGCGGGATTCCGTTTGTCATGGCCATGGCGCGAACGTAGT
CTGGCTTTTGTGTGATGCCGAGGTGACGCTTTAAGGCGTCTAGGGCGTTGCGCTCTAGCTCTCCTTCGGGCAGCGAAGCCACCTCGCGGAAGTGGGCACC
GCCGCTCATGACGCTCAAGCGCGTCTGCATCGTTCCCTCAGCATTCTGAGCAGGGAAAGTGTTGGAATCAAATACGACGCCAAGCACCTTCTCGCGCTCT
GCAGTGGGGATCAGATACCCGAAGCCGTCGGTCGCCAGCACCGAGTCGTTGTATCCGACGTGCACCATGCCCATATCCACGAACTTGATCTCGTTCAGAG
CTTCAGCTAAGCCGGGAGCTGATTCTTTCACTGCTGGGGCCAGATAGCACGCTGGGATCGTGGAGAACACGTGTGAGGCCGTAATCGGCTCTAAGATCTC
TCCAGACTTTGGGTTCTTGCTCTCCACGACGAAACTGGGACCTTTTGTCGATCCATTGTTGTGCCCATGAACCTCCAGCCTTGTCACCTTCGTGTTGAGA
TGTAGATCTGCCATGGGGTCGTTCTTGATGCTGTCTGCTAGTGCATCCATGAGCGTGCTCATTCCGTCTGTGAAGCTCACGCTGACGGACTTttcgtgct
tcttgacaaAGTTCGACTTCTTTGTGCCATCCAGCAGCGTATCATCGCTCTTCAACCCTCCAAGCAGCATGCCCTTCACCACAGATCCATGTTTCCTCTC
AAGGTCCACCAACATGGAAAAGCACGAGCGCATTGAGAGCTTCCGGATATCTCCACCGAAGATGCCAGAGGCCATGGGGTCCAGCAGTCTCTCCGCCACC
AAGGGGCTGAACCTTCTAGCTGCAAAATTGTACACAGACTCGTCCTCCATGGCCCCAGGCTTGATAAACAGCTCGTTCAGTGCTGCACGTGCCACAGCCA
ATGATAACGGCCAgcgcagagcttccagtAGCGACGAGGGCACCTTTTCCACTTTGCCATTACGCAAAATGTAGCGCGCCTGCGCCGTCGGGTCAACCGC
CTGCATCTGACTCTGCAGCTGTAACTGCTCCACCAGGCGCAACATTTCAGCTCCATTGCGCGACGGACGGAAGCCACGCGGTCCTTCCTCGAACAGGAAT
CCCTCGCGCTTGGCCGTGTGCACCCATCCACCGGAGATAGCGctggcgtccagcacgcggaTGCGCGTAGCGTCGGCTGCAGCCTTGGGCAGGGCCTGGC
GGAGGAAATAGGCCAGCGTTAAGCCCGAGATGCCGCcgcccagcaccaccacgtcgcGTGCCGCCATACTACGTTGTTGCTTGGTGGCGAGATTGGGAAT
GGCAGATGTGAAGCGGATACATTTTTCAGTTACTGAATTAGATGTGATATTGCAGAATAGTACTGCTAATATGTATAATGAGAGATTCAGCTCTGATATT
AATGTTGATCAATTGATGTAATATCAGTATATTTGGCACCGTGTGTACAGTTTGGCGCTGAATGTAGCTGGTAGAAATGCAGCAGTGAACTCAGATTGGC
TAAAGCAGTTTTATATTTACTACCGGTAATCCTATTCAAGTTGCATACAGTAGATGTTGACGCCTCATGGTTAGCAGGTCAGATGGACAggactccgcga
cgaaggccTCGCCGGTAAGTGCATGAGAGAGCGCTACGTGAGCATCCGCTTGTTCTTGTAGTGGAGGTTGCAGGTGGCATCCTCGTCTCGGTCGTGCGCC
ATCATAGCCGCACCGGTAGCTGTTGAGCTTCTGATCTTCATCTCTTGAACTGTGATAAAGTCTTCCGCCGGGGTAGCGTCTAGCGCGCTCCTCTGACGTC
TGAAACGAGTAACCTTGCAAAACGCCATTGCGCTTGATATCTTGGCCCAagactcgtcgtcgtcggacggATCAGACTCaacgatctcgtccatgcTGCC
CTTGAGAGACTTGGGTAGTGCccaaattggagaatgacgAAGAAACGTTGGGGGTAGCACTCCCACCGAAGCGAAGATTTAGAAGAAGATTGCTCTGGGA
CGCACCAAGTTGCTGCCGCCAACACCAAACACCAGCTTGTCGAGCGTGTTTCACACCGATAGGCAGTAGTGAGGCAAACAAATATGAAATGTTGTAGAAT
GCTAAAATGTTTTTGAGTGAGCAGATAGCCTGCCAGTCCTCGACCATTATTAGGTTCGAGGCGAGACTACTTTAACCAATGTCTAGACGGTTGGAGACTg
caccttcttgcccttgaagaGACCACCAAGCGCACTCAAGCCGCCCGCCGGTCTGCCACTCTCTCCGTTTGGCGCGAGGCCTTCGCTctccgccttctgc
tgcttggcacggcgctccagctcctgcagtcgCGCCTCCAGCTGGTCGTACGTGCCCTTGGCCACGCCGCGCAGACGCTTCTGCAGGATAATGGCCGAGA
TGATGAGAGGCAGCAGGAACAGACTCAGGAACAGTGCGCACAGAGAGATACCCAGAGTCGTGCCTAGTACGTTGTTACAGAGCGCCTCGTTGATGGCGTC
GAACGACAGATTGGCCCAGGCGCAGTCGCCCGAGCAACGCGCCTGCTCCACCGACGTCATTAGGTTGCGCACAGCGCCATTAGCACCCAGCATAGTCGAG
AGAGGACCCGTCTTCAGCGCTGTGATCTTGGTGAAGTAGTTGCTGGCGAACTCGTGGATGGACATGGAGTAATTCCAGAGGTCCGGGAAGTTCTTGCCCG
TGTCTCCTAGCAACGTCTCGCGCATCTCATCCAGCATTGTGCTCGCTTTGTCGAAGGCCAAAGCGTACTCGTACGCTTCGTAGAATGCGAGCTGGCAGGC
AGCCTTGTACGTCGTCAGCCCGGTGCTCGAGTCGCACAGGCCTCTCATGTAGCACACAGGCTGTTCGTCACTGGTGCTGTTGACGCACCCGTAGGCAGTG
GCTGATTCTTTGTATGCCAGCCAAGGAGTCAAGACATTTTCCTGTGTGAACTTCGTCGCTGGTTTCTtgcctgcagcttcggctGCCGTGGCGAGCTTGG
CTACAAGGCTCCTCGCTTTCGTCGAGTTAAAGTTGAAGTCGGTGAGATCGTAGTTCGAAACGATTTCGCCGTAGCTCGAGATGATCGTCGCCATCTGCGT
AGTATCTGCAGCCTTCAAGACAACGTActcgtcctccacgttgCAGGAGAAAGACAGCGGGACGTCAAGACCCAGCGGGGTGAAAATGTTACTGCCGTTG
AAGCAAGCATTCGCCATTGAAGCCATCTGCGTCGATGCGTACGGCGACATATCCTGGTGCAGTAACTTCATGTATTCGCAAGAATCGTACCACacagcac
cgacagcaaGCAGAGAAGCCGAGAGGACAAAGCTCAGCACGCACACGAGCACACCCAGAGACCAGCTCACGTGCAGTAGGTGCACCCACTGTGTCGTCTT
GCTAGTGCACgcgttcttgacgatggcAATGATGCCCACAATCGACGCGATCATTCCGAAAAAGAAGACGCAGACCACAAGAGCACTCCGGGAGAAGGAG
AGGTCGttgaacgtgctggtgagTACGTCGACAATAtccatggagctgttcaTGGATGCCCCCAACGCCGTCATATCCCGCACCGCCGTGCGCAACGTGG
AATCGAGAGCTGTTCCGTTCGTCACGAAAGCGCTTTTCAGCAAAGTGACAGAGTCTCCAACCACGTCGCTGCTAGAGGAAATGGCAGCGGCAGTgttgtt
gacgaagaacgtGACCGGTGAGCCACAAACCCGGTCGGGGCATGTCATACAGAACGCGTCGCTTGTAGCGGGGTCGCAGGTCAGTGTCGGGAAGGATCCG
TGGTGGTAGTAAATGCTGCCAAAGTCCGCGATCATCTTCCTAAGTGTAGCGCCATCTGCAGCAATCCAGTCCGAGTTCTTGAGCTGAGTGCTTACTAGCT
TCGATGCAGCAGTTAGCTCCGTCGCGGCACTGTTTAGTGGGGTCAACAGGTTGGCCACGAAGATATTCGCGTTCTCTAACGTTGCCTTCAGCGAATATAG
CACATCTTCGACGCCATCCGAGATGTTCGTGTTCAGTGCAGCAGTGATACACATGCAAATAAACACTGCCAGCGAGCACACAAGGAACGTAAGGGTCGGA
ATGATAATATCGCAACGTGAATAGCCCTTCTCGTTTGGCTCACGGCCGCCACAACGGTTGAACACGCACcgaagcagcacgaagccgaTGCAGCCAAGTG
CCGTGAGCACACCCATGACGGTCCCAGGGGCTACAAAAGGGGCCAGTGAACTGGGATATCCCGTTGACATCCACTTGGTCGCAGTTGTAACATCCTCATC
GGTGAAAAGCTGACGGCGGGCATCCTTTCCACCGGGGACGACGTCGTCCCACTTGCAGTTGCTTCTACGCTCGCACTTccccttgctgctgcacgagttc
GCGTCGAGCATCCCGACGCATTTGCCGTTGATGTCGCGAACGGCATCAGCGCTCGAGGAATCCACGCAGCGCTCCAGTTCTGCATCTGTGGAAGACTTGA
CGCAGACGTaggtggtgaagctgaaCAACGAGTCCTTGTACCAACTGTCGCTCTTTTCGCGCATGCCCGACATGGCGGTGTTGCCTGCAACAGCACTCAG
CTTAAGGGCGCTTTGGCGTGCCGTTTTGTAGGCAACCATCGCGTTGTTCTCATCTGCATTGATCTCTGCGGATGTCATCCCCGACGGAGAGACGTAGTTG
GTGTTATTCGCAGTACGCACAGGACAAGTCCCTTGCCACACCAGATCCGCTGCGGCCGAGCAAGTCGTTGCCCACGTGGTTGTGGTCCCGACCACGGGGT
TCCACCCCATTGTcgtgctcagcagcaacgcgagtCCCTCCCAATAGCGCATGCTGGCAGTCGCTTGGCCTCGGTCTTCTTGCCCGCGGTCTCGCTGAAG
CCGAATCGAGaatgagctgcttcagtggCCAAAACGGACAAGCTCACTTCGCCAGACAAGAAGATGTTACCATAGATAGCTGGAGTTTTTCACCTAAAAT
GGACTTCGACATGGATCCAGTGATTGATAAATATAGGGAATTGCTGGGCTGCAGCATCGCATCGGCATGGCGCGTTGGACCTGCACTCATTCTTTTGATA
GTCTTCGCCCGTCCAATATTACTCGGGAGGGCATACAGACCCTCAAGCTTCCGGCATGCCTATCTTCGCGATAGGTAATGTAGCTGGACAAAACTTTTAG
CACATAAATACATTccaaagttgaagttgataTCTAAGCGTAATCACTTTTTACCAGCATTTGTTCTTGTCCACTATGCTCTCTAACCCCGTTCTTGGAT
TCAGAACGCGGTTAGAGAGCATAGGGAGGAGATACATTTCCAAAGCTTCACCGTCCTTCAGGACGAGCGCCATGCTGGAgtcgcacaagaagaagaagaa
ccgccACGTGTCCAAGCCTGCCGCCGCGCGTAAGACATCGCTGCCCGCTCCCGCTGCGCCAATCTCCAACAGCGCTACCACGAGCACGTCGCATCGCCGC
GACCTGCTGGATGGGTCCATCCAGGAAGTCTCACGCAAGACGCTCATGGAGAGATTCCGCAAGCGCGGACGAGTGGAGAGCGCCAGCTACGAGAATGGAC
GTGACCGAGCAATGGCCAACACGACACTGCActccaacagctcgtccttctcgaccTCAGGTCCCATCGTGGTGCGCGGGGGGCGAGCGCCGCACCATGC
GACATTCCTGGTGCATAAGAACACACTGGCGAGGCCGCAGTCGGCGCCCAACCTCATGGAGCAGGTTTGGTAAATAGAATATAGTATGAGGTAGACTGGG
ACtgacgttgttgttgttgttgttgttgtaggCGGACGACGAAGTGATCGCACGAATCTTCCCCGATATTTGTCCACGTGAGCTCCGGATTGCAGAAGTT
AAGTCGTGGCAGTCTCCGTGGATGGAAAAGGAGTTTCCAGTCTCTCCAGAGCCAGAAACCAAGGTGTTGAAACAACCACAGCAAGGAGAACTGGTAACAA
ATGCTGCAAAAGAAGGGAAGAGAGCGTTGTCGGTGACTTTAAAGCCAGATAAAAAACAATCGGACATCCCAGCTCCTCCGATAGCAGCTAACAGCAATGG
GCTTCAGCGGAATACAGCAGATAAAGCGGCGAAGGAACTGGATAAGGAAATCAACTCGCTGACGAACCAGTTGTCACTAGAAGAAAAACGGTCGAGGCCG
CAGTCCCCGCCGAAAAAGACGGCGTGCTTGCAAACAGCAGGAACGCCGCCTCCAGTTTCTACCCCACGCACTCCGCAGTGGAAAGCAGTTGAATCGGCGA
AAAGAACCCAAGGGAATCGTATTGGAAAGAGGCCGCAACTACGCCTTAAGCTGGAAGACATGCCTACGCCCCAGCAAGCTGAAGAGCGGGCACAGCGAGC
TGCCACTCGACTCATTGCCAAGCGAGACGCAATGGAGGCCGCTGCGATTGCGGCCGCAGCTGCATCGGGATCAAATACGCCTTCAAAAGGTCTAAGTGTC
GCGCAGCAAATGATGATGAAGTTGAATTTTAGTTCAAGCTCCGACTCGGATCTTCACTCTCCAAGTGGTGCGGTTTGTTGGCGTTTTATGAATGGGTGAA
AGCTCCTAACTTCGTGTTTATTTGGGTGTTGAATTCGTGTAGAAGGCGAACGACATAGCGCAGGAAGCGCTTACTCGCCTAATCACGGCATGTTCACGAC
CAGAAATGTTGCCGTATCAGAAGCAGGTATTTCATCACCTGATGCTGCGTGTTTGCACCTGCAAGAGAATCTTGAGCGCGTGAAAGAAATCGGCCGGGGT
GCTTCTGGTGTTGTGTATAAGGCGATCCACATTCCGACGCTGAAAGTGGTCGCTGTTAAGGTCGGTACTTATCTTCGAGGTTGGAAGGTGTGTGTCATTA
CTCATTTATTTTTTGTTAATGCTGAAGGATGTACCTGTTTACGGGCGTGGCCAGCGCCGACAAATGGTTCGCGAGCTCCATGCGCTGTATTCAAATCTTG
CACCCATGGCAGACAATAGCCCAACACCAACTGGAAAGAGCACTAGCAAGCCCAAAGCAAAGTACGTACCCGCGATACATTTGACTATGCCGTTGgtgat
tttttttaacgAGGCCAAATTCTGTTCGAAATGTCTAGGCCTAGTCCCTACATCGTTTCCTTCTACGATGCATTTGTTGATCGCCCCAAGAACTCGATTT
GTATGGTCATGGAGTACATGAGCACAGGGTCATTGCAGGATATCGTTTTGCACGGTGGCTGCCAAAATGAAAAGGTCCTAGCACGGTTATCAACGGGAGT
ACTGCGTGGTCTAGCTCACATCCACGACAAGCGGATGGTGCACCGTGATATTAAGCCGCACAATTTGCTCACCAATCGACAAGGCGAAGTCAAGATTTCG
GATTTCGGTTTGGCACGCACGTTGAATGATAGCTCCACATCAACAAAGACGTTTGTGGGCACCCTTCTGTATATGGCCCCTGAACGGATAGGCGGTGGTG
ATTATTCATACCCAGGTAAGGCGGTACCATCGCTTTGTGCGTTCACTCTCATAAACTGATCTGACTGTTTTCAATGTGATATTAGCTGATATTTGGTCAT
TCGGACTTGCGCTGGTTTCTGTTGCTTTGGGCCGCTACCCGCTTCCGACGCAGGACGGGTTCTTCGGCTTAGTTGATTCTGTAAGTGATTTTTATTTACA
AAGGATTGGTGTTGTAGGGTTCCTGACATGGTGATCATTTTCCGTACAGGTTGCAAATGAGCAATGCCTCAAATTGCCAGCCGAGTCATATTCAGAAGAT
TGCTGCTCTTTTATCGACCAGGTCTGTGAAAAGGCCGTGTATTCGATGCAATCTGCGCACGCTGACTGTCGTGTTGTAGTGTCTAATGATTGACCCAGAT
GAACGGCCATCCGCAGAaacacttctccagcatcctTTTATCAACAAATTCACACCTGAAGAAACCCTAGTGGAGGTAAGTTGTCCGTTGGTACACCTGG
CAATGTCAGTGTCAGTGACGTGGAGACGTGGTGTTTGACAATGCGATTTCTTTTGCGATGGCAGTGGACATCGTTCGTCGATCGGGTGCACCTTTGTGAA
GAGCGAGGTAGCGAACTGGAATCACTCAGTGATGCAGTCTATCGTCACATGTATGAGCACTCTGTCAAGTTTTCCCACCTACCGCAGGTAAGTCTTGCTG
CGTGCATGTGAACCCCTTGCTTGTAAATGTGTCTAAGGGGCTATTGTTTTTATGGATTCAGTCCGACTACGGCGTATCGTTTGTATCGCAAGCCACCCCG
ACATTTTCTCGACGGCAAATATCCCTACAACCGGTGCAAATGAGGTGGGAGCAGCTCTAAAGTGGAAGTCACGTGGAGTTTATTCGTGATGACCTCCTTT
TCTGATTTTGTTTCTTGTTATCTGCATTAGCTTACAGCTCGGTCTGGCCAATTACCTGGATGTGCCTGTGCATATTGTCTACGAGAAATTCGAAGAGGTG
GGTTCTCGTTTAGGCATCAATGCTTGATTTCGACGCAACAACTAACGTACTGCACAATTCAGAAACGTTGCTTATACAGCGACAAATTGCTGGAAGATTA
CTGCTACTCTCCCCAGAGCTGGACAGCCTCACCTGGTATTGCAAGGCGGCAACAATTCGGTATCGGTACGGACAGTCCTCAGCGTACACCAAGTGAGAAG
GGCTCGTTCTGGAGAAAACTGCAGGAGAGTATGGCTAAACTTGGTCATAGCAAACGCAAGAAAGAGCGAGAAAGAGGGCGCTCGTCGGCATTATAACTGC
TAGCCGAAATTGCCGAAAGTGCCGCCATTGCAGCTAAGCACTGATGAATACAAACGGGAATGCGGCATGCAGACACCACCTTATGACGGATAACCGATGA
TATTATCCGGTGTCTAGCTAGACTCTGTGGGGTTCGATTTGGGAGTATCTTTGGCTGTATCCGGCGAGTTGAGTTTTGCAATATCTTGGCATGAGACAGC
AAAGAGCTCCAACCCCTTTGCATAGTAAAACGCGTGCGAGCGAGCCAACTCGCTCACGATTTTCTGCGGTCAGAATCATTAGCACAGGTACAACCCCTGC
ATCTAAGCCATTCCAAtgcaccttcatcttctgaATGCGGTAGCGGTCGAAGTTCTCCACGTGTGTGTCCAGGAGTGCATTGACGTTTTCCACACGCCGC
TTCTGGTCCGACAGCATccgcatcttcttctctttctcttttGAGCTTCCTCGCTGGCAAAAGCACCAGTCAGCAACGTCACAGTCTAGTTTTCATCCTT
AAACTTTATCGTGTACCCTCATTTCATCGTactccttctgcagcttggcttCGATCTTGATTGCTTTCTCTCGATCTTCTAGCAGTCTCTAACGCAGTTT
TTAATTAAGTCAGTAGCTGTCATTTTCCGCCTCTGCTTGCCCTTCGCACCTTCATAGGTACAATCGCCCAGTCCTGGATCTGAGTAACCACCTGCAAAAT
CTCCGTCTCCGGTCGTAGCATCATCACGTCGTGGCTCTCACTCACCAGCGTCTGACCGCATTCGCCCAACCCACCGAGACACTGTGCAAGGGGCGCCCAT
TCCTCCTGCGCCGCAATATCCTCCAAACTCTTGGCGAACACGCCCAGGAacgcctcctgctcctctctggccttcatcatctttgccaccagctcctcca
gcgcacGCGCATTGCGCTCCATGAACTGCAACTGCGCAGCCAAGCGTCCACGCTCCATCGCAAATCAAACCTTGAAGTTGaatattttatttttttttac
tttaTCAAATGTTTTACAAACATTTTGCACAAGTATATTAAATTTTGAGGTAACATTTGTGTACACATTTTTGGGCCAACAAAGCCTGGAGGTGTTGCTG
CGAGTTGTTGCGGTGCTTCGGCGCTCTCCCCTCCCCCTCTATCAGCCATGCGGATCATGATCAAGGGCGGCGTGTGGAAGAACACGGAGGATGAGATCCT
CAAGGCGGCTGTGATGAAGTACGGCATGAACCAGTGGGCGCGCGTGGCTTCTTTACTCGCTCGCAAGTCGGCCAAGCAGTGCAAGGCTCGCTGGTACGAG
TGGCTGGACCCGAGTATTAAGAAGACGGAGTGGAGTcgcgaggaggaagagaaacTGCTGCATCTAGCCAAGCTCATGCCCTCCCAGTGGCGTACGATTG
CCCCCATCGTCGGTCGCACAGCTGCGCAGTGTATGGAGCACTACGAGAGGTTGCTGGACGCCGCCCAACAGAAGGAGGGGGTGGAAGTTAGCGACGATCC
GAGACGGCTACGTCCAGGAGAGATTGATCCCAATCCGGAGAATAAACCGGCACGTCCCGACCCTGTGGACatggatgaagacgaaaagGAGATGCTGTCC
GAAGCGAGAGCTCGTCTGGCCAATACGAAGGGCAAGAAAGCCAAGCGTAAAGCTCGTGAGAAGCAGTTGGAAGAGGCTAGACGTCTCGCTACATTGCAGA
AGAAACGGGAGTTGAAAGCTGCGGGCATCATGTCGTCCAACGCGAAAGTGCAGACGAAAAAACGCAAGTTCATCGACTATTCCAGTGAGATTCCGTTCGA
GAAAAAAGCCCCCGCCGGGTTCTATGATGTGACAGAGGAGAAACGCGTTTCCAGTAAGGGACTGGATCCGAAGCGtgcagcgctgcagttggacaagctg
gaggGAGTGCGTCGTGACGctcaagagaagaaggagcgcaagcagGATGCCAAGAGGCAGAAATCGCTCATGAAATCCAACCTTCCGCAGGTTATCGCTG
CCGTAAATGCGAAGAATGACCCCATCAACGCGATTAAGCGCAcggcactggagctgcctgCTCCTGTCGTGTCCAATGACGAGTTGAGCGACCTTGCCAA
GCTAGGGATGCATGCCACTCATGcagctgctcttgctcttgagaACGGATCAGCCACCGAGACACGTGCACTCATGGGCGACTACAGCGCTACCCCGCTG
CGGTCCACCACTGGAGGTACATCGGCAACGCCTTCAGGTCGCGACGTTCACGACAATATTATGCAGGAAACAGCTAACCTTTTAGCCATGAGAAACAGTT
CCACCCCtcttcttggtggcgagaATGTCCTGCTGTACGAAGGAACAGGCTACGCGGGTGCTACTCCATCCCGGACCCCGTCGTCAGCTGCATCCGGTAC
AGTCAGCGACAAGACGCCCATGTCCGCTACGCGCACACCTCTGCGCGACGAGCTAGGCATCAACCCTGAGCAGCTTTACGGGACAGAGGTCGAGAACGCC
AAGGCAGAAAAAGATCGGGCAAAGCAGTTGGCTTCTAGCCTGCGTAAGGGATTCGAAAGTTTGCCCGCGCCCCAGAACGAATATGAAATCAACGTTCCGG
AGAAAGAGGAGGTTGATAATGATCACGCCACTGCTCTTCGTGAGGAAGACGCCGGAGAGCGCGAAGCTCGCGAGCAACaggagcgcgagctggaACGAGA
ACGTGAACTTATGCGACGGTCTACTGCTGTGCAAAAGGGGCTCCCTCGTCcgtcgaaggtgaagaagatgctggttCACAGTGAAGTTGGCGAGGTCGCA
GACGAGATGCACCAAATGCTGGAGCACGATCTTGCCGTGTACCCCGTCGATGATGGAAAGACAAAgaaaagcaagaagcgcaagaaatctccagctcctg
ccgttgttcaacttcaacagtTCTCTGACAGTGAAATAGAGCGTGCCCGGCAAATGGTGCACATTGAGGCCAGCCTAAGTGGCGTGGACAACATTTGGAA
AGTCCAGGACGCCGCAGCTCTTGGTGCGAAGTGGGGGGAAGTGCAAACTCGCTATTTAAGCAAGGCTGAAGGGAAGAGTGCTGGCGTGTCTTTCCAGTTC
GCTACGTCTGACGAGGACAAGCTgcgtgctgctcaagctcgcTTCGCGGAGCTAAAGGAGACTGAGCAGTTCCTTACGAAGCGTGCACAGAAGCTAGACG
AGCGCGCGCGGGTTGTGAATGGAGGATTCTATCGCCGCGCACAGCAagggctggagctgcttcatgaACACATGACCGAGCTGCAGAATGCTGCGATCGA
GCGGGCCTGCTTCGAGAATCTGTCAAGTCTTGAGGCCCAGGCATTGCAGAGCCGCATGGCTCGACTGGCAAACGATGTGAACTCACAACAACTCGTCGAG
GTAAAATTGCAGAAGCAGTATGCAACGCTGTCCCAAGAGCAGTCGTAGTGATACGTCACAGTTGCAGCAGGTGTCTCTACCGTCATAAAAATCGCAATCC
TTCATCCTTCCCCAGTTAATTTCTACTCGGAGCCTCTCTCTACTTATCGTCATCCGTGAACAGCACCATTTTCGCGGATGGTGACGTGCTTCGGCCACGT
CCGATGCGCAGGTTTTCAAGTGAGTACTTCCGGTGCATGAGACTGATCAGAGTTTTAAGCTCGTGCCATTTCGCCGACATCGTAGATCTGTGAGCATCAG
CCAATTGGTCAAGCTTTCCCAGCATAATCTTCATTTCCTTCGGAGTGAGAATGTTGAGGAAGGCTTGCAGCGCAAGATCCATCAATGCCACCTTCTTGCA
CAGAAGATCAAACGGCGGTGATTTCTTCGACTCCTTACTAGTCTTGCGCGTCTCCACGTACTTGCTTGTCAAGTCCCCCACGATACCTGCGACGATATCT
ACAACAAGCCCACTTTGGATTGGAAATTTTAGAGGCCGCTCAGACGAAATCTGCATAGAAAACAAGCATTAGTCCAGCCGTACGTACAACCTCGATCCAA
GCGCATTGACGTTACATACCCCTTCCTGTGGAGTTTTGTCGATTCGATGCTGCAAAACGTAGATCGCCAATCCTGTGGTAAGTTGTGTGCCGCGCATAGT
GCGCGGAAGTCGGCGCGCAACAGAGAGCCACCCTGCAGTCGAATCGAATAAGCCTTCATTCGCGCCAGCAATgcgaagaacgagctgaGGCGCCCACTCC
CTTCGCCACTCGGCACGAGGAAATACGTCCAGGAGTTCTTCGATGCAGATAGTGGCCAGATCGACGATACTGGCGTGTATGTTACTCTCGAATTGCATTC
GAAGGAAAAACATTGTGAAGCTGAACGCGTCGTAGCCTTCCAgcttgagcgtcttcgtgcGCAGACAAACCACCAAGTACATCAGCACGTAGTGCATATT
CATGGTCGGAAACGGTAGCAAACGAGTCTTCTTCGATGGTGGCGTTACTGGGATCTTGCTCTTGACACTCATCGATCGCTTGCTATCCTGGAAACCGTAG
GCACGGAAAGCGTTGAGGAAGTCGTAGATGGAAGGCTCCCACTCCATCTCGATGGATGGCGTCTGGGTGCCAAACGCTGAAGCGAAATCCTCAATCGGGT
GCGCGAAGCATGCCACAGGTAGAGCGGAGGCCAGCGTTGACAGGGATGTTTTCTTCACAGAGCTCTGAATCAGGAAGAGATTGCTGAAACATCCTCCGAC
CACGTGACTATTGCTGTGAGTTGACACTAAAGATGCATACAAGAAAGTGTCAGTCGTTAAGCTAAAACTCTCCAACAGCGAACTGCACCGTACTCGTCAT
AAACAGCCATGATCCAATCTTCGAGGGCAGCATGATGGGCGTCACCGCAGAGCCTCTAGTGGTGGATTCGctcttgcgcttgagcatgCATCGGATCAGA
ATGGCTTTGGACCACAGCAGCCCGCtcagctcctcgtcggtcGAAGACTGCATGGTCTTGTACACGAGCTTGAGATCGCTCTGCAactccgtctccgtcg
cctTGTACGTGTGATACGGCAGTGGCTAAAACAAATCCAGAAAAAGTTACTAAAACTCGTTAAGAAAAGGTTTCAACGCTAGTGACGCACCTCTGTCATG
GGAGTGAAGACGTAGCCGAacttctcctccgtcaccGTCACCTCTGCGGCCGTAAAGAGATAGTTATCGCCCGAGAGCGCCGACATGTTGCTGTCCATGC
TGCTCATGAGCTTTCCCAACGGCGCGTCCTTCTCGGCGGCCTCACTCtcctcgcgcagcttctgcatcttccgcTGTCTGTTCTCGCGCTTTCGTTTCTC
CGCCAggtcgttctgcagcagcgcgtcgaGGCTTGTGAACTCGTCCAGGATGGCGCTGGCTTTCTGACGCTTCCCTCGGCCACGGCGTGTGTCGCGCAcc
atctcctgctcgtcctcagACGATGAAGGATCGAGCGAAGCATGACGACGCTTAGAGGCCGCGGGTGCCTTTGTGGCGCGCGCACGCGACGGAGCCGTTC
GCGCCATTCCCAGGTACGATGTGTGCAGGCAAAAAGCCGAATGAAGTAATGTGACATTATGATGTTGTGAATTTTACGTTGTACTGTAATATTTCGCAGA
AAACTGCATTTTTTAtgtggacgttgaagtgcttgtacatgtacctgtgGTTCAGTGGACACCCAAGTAGACGACCATCAAGCCCGTTGCGTTCACATTC
AACGCTGACTACAGTAGAATCAAATGATGTCCCCGACAGCTGCGGCTGTACGGCGAAAGCCTCCAACTTGGAGTCCGAGCCTCCCGCTGTATGTGGATCG
TTTGAGGGAAGCGTCATTTCGATTTGAGGGAGTTCCTGCAGGTGCCCGTACGGCGTACGGTACGCTCAAACTATTTGCAACAAACTAGTGGTTGGTGAGC
GTTTGCAAAGTATCCAGTACCTCACTCTAGCAATGCCGAGATTGGCTGTGCGGGATTACTTGAAGTCCCATAGTGTTTGGAATCGGATATTGCCGACCTG
CAACTCCTGCCATATCTACACTGCAGCATGGTGTCTgcagattttttttttttagttcGCCGCTTGCAAATCACACTCGTAGACATTGCGTTCTACAACT
GTACTGTTTCAGCGGTCTTCTACTGGATCGCGGTTCAGAGACAGCCACACTTGCGACTCCACCAACCGTACAGCGTATCACGTACTCTCGCAAAACAACG
AGCACTATCCTAATGAGCTACGCCCACGAGAGCGGCGAGCATGAGCGTGCATGTATCTAAAGTTTACTTAAGTAGATTATAAACATGCATGTATTTCAGT
ATGTTTGACACCGCCCTGTTTCTGCTTTGTTTTGGAGCTTCGATTATTTAAAAATGAAATTCTGATTGGCAAAAAAGTGGCTTAAAATAGCTGATTGGCT
AAGGCAATCCATGGAACAAAAGCGAATGGAAAAATGCAATTGAAGATCGCGATGCCGGGGCCTCATTTAAATCGCCAAGCAATCGGGCAGTCAAAGCTTG
ATCcaagccccccccccccctcccgTTGTAGGCGCGTGTACGTGCGTGCCACAGCTAGTGAAGCTACAGCGGGATTTGCAGTGCCTACGCTTCAATCCAA
TTGCTTTTTTGTGGCCGTCCATTCCTAAGTGGTCGCGCCCGTCTGTCAGTGTGAGAAACGAAACCCCCGCCCAGCGGCCGCAGGAGAGCAGGAGCGAACA
CCTTGAGATCCTCCACGGCAAGAATAGGCGCATCCGTTTGTCCTGCTTCTGGTCGAGCCACAAGTGACCCAGACAAACTTGAGAAGACTCCAGAGAAGAG
TGACTATTGACCCCCTCGCTTCTGCATGACGCAAGCAACGTTACAGGGGGAGATCGGAGAAGAGACCCGAACGGGAACAATGTCCAGGCTCAAGCACACC
AACACTGGCGGGTTAGAAGTCAACATGGCAGAACCAACAAACGAAGCTGATGCAGAGTGGGGACAGGTTTTCTCAGCGGGCGAGAGCACACGCAGCTTCG
TGGAAGGTAGGGAGGGCTCTACCCTTGTGAGTGGAGATGAATTATTGTTAAgtacttcttcgtcgtcaattTCTTTGCAGCTGAAGTGATTTCTGCGATT
GAGTACGACCGATCGGGGGACTTTCTAGCCACTGGGAACAAAGGAGGACGAGTTTCCATCTACTGCCGTCACGGAACTCCTGCATCAGTTAGTGCACTAG
TTAACTTTTGCTTTGTGATCTTAACACTAATGGTTTATGTGTTTGATGACTATCAGAACCAAACCATGTACAGCGGGGTAAACACTGATCCGCAGTACCA
ACTGTACACCGAGTTTCAGAGTCACAATGCTGAGTTTGACTACTTAAAAAGCCTCGAAATTGAAGAAAAGATCAACCAGATCAAGTGGTGCCGACCCGCC
AATGGATCCCAGTGTTTGCTGTCCACCAACGATAAAACGATTAAACTCTGGAAGATACACGAGCGGAGCGTGCGTGAAGTCACAACGTACAACGAACAGG
GTCTTGCTCACGTGCCACGGGCACACATAACATCGGAGCTTATTCGGTTGCCACAGACGCATGTACGCGGGCAGGTTACGACAACCACAGCTAAACGGGT
TTACGCCAACGCGCACACGTACCACATCAACTCAATCGCCATCAACAGCGACGGAGAGACGTTCATGTCGGCAGACGATCTCCGTGTCAACTTGTGGAGT
CTTGGCGTCTCGAATCAAAGTTTCAGTGCGTATTTAGCACGACAAGTGCGATTGATGATAACAGCACTTGCTAATGACTTGTCAATTATGATTTGCAGAT
ATCGTGGACATCAAGCCAGCCAACATGGAAGAACTTACCGAGGTCATCACAGCTGCGGACTTTCATCCGACACATTGCAACACGATGATGTATAGTACCA
GTCGCGGTGCTATTAAGCTCGGAGACATGCGGCAGTCAGCATTGTGTGACGCATACTCTCAAGGTGCGTACACTGTCTGATTGTGCAGAATGAGTCACCT
CATTTTACATCTTGCAATGGTATAATAACTGAGATTTGTTTCTTGTTTACTTTGGTTCTGTGCAGTTtttgaagagcaggaggaccCTGAAGctcgaagc
ttcttctcagAAATCATTGCGTCCATCTCCGATATCAAGTTCTCACCTGACGGTCGCTACATCATTGCTCGCGACTTCCTCACACTGAAAGTATGGGACA
TCAACATGAACTCGCGTCCAGTTCAGACGATCAATGTAAGGAGCTATCTGTGTGATACGAACCGTTTTTTTTCCATTGCTAACGTATTGCGGTTCTCTAT
GGTTTGTTTTATTTCTTCAATTGCAGATCCACGAACACCTTCGTCCACGGCTGGGAGATCTCTACGAAAGTGATTGCATTTTCGACAAATTCGAATGCGC
AGTCAGCGGGGACggcaacaacttcatcacgGGCTCGTACAACAGCGAGTTCCATATTTATGATCGCTATGGACGCGCCGATATCTCCATCACACCGCGT
ACAGCGCGTGTGAGTCGACGCCATTCCATGCCACAGCGCGGTCTTGCGCAGCAAATAGCTGCGTTGCCTACTCCAGGAGACCAGGACGCGTTGGATttct
cgaagaagatcatgcaGACGAGCTGGCATCCGTCGCTGAACGAAGTGGCTGTGTCTATCCGCAACAGCCTCTTCGTATATGGTGCCTAGGCGAATGGAGA
TagtgctggacgcgctgtTAAGGTAAGAACTAAGACTGGTATGCGGGGAGTACCACAGTGAGCAAGGGGGTTCAATCCAAAGAAACAGCGAACACGAAGC
AACCGAAGTGCAGGCTCTATTGAATTGTTTCAAGCTAGAACGAATTGAGGCTGCTTGTTTCTGTCGCTAGCTGGCCGCTGTGGAAGTATATCAAGGGAAA
TATCACGAACTACATCAAAACAAAATAATCAGCGCTTCTGAGTGGTTCGCTATCGAGTGCTTTGCTATCCACATTTGTCGTCAAAACTTCCCTCTGACAC
TAATTTTCATTGCAATGCATGTAACGGTATGCGCTAACACTTTTTATTGCAGTCACAGATTTGGAGCTTCAATTtgccatttttttttatgtttTTTGTG
TTTTGGTGGTCGTATCGAATGCACCCAACTCGAGCACCGAAAACGACGCGCGACCACTACCTGGAAGcaaaacaacttcaacgtgtgACGCAAAGTATCT
TCTACCTGGTAGTCATGGCTAGTCAACGGTGGTGCGTGCGGCTTTTAAGAAATCCTTCGAAGACTTCGATGGCCGAGCAGCAGATAGCACCACTAGGATG
GCAGGGCGAATGGCCTCCTCTGTATAACGGgatggaggaggtggctgGGATGGCGTACGAGGGGCTGCCTCCAGGCTATGGGAGCGACGCATCCTTAACA
CTCGATGACGGCGATGCATGTAGTTCTCACACTAAATCGCCACCAGTGGACTTGTACCAAATGATGTTggatgctgaagctcagcaagcTGTTGTCCCTC
AACTGCTGGCGTACCGACCCAAGGCCGAAGATCAAAACTCCTTTACCCCTAATCAAGCTCCTTACCGCCCCAAGGGCGAGAGCTTCGTCCGTCATGCCTC
GCCAGTCGCCCCTGCAAATGAACCAGCGCCCATGAATGCGTCAGATTGGCAGCTCATATTCTTTACTGGCGATACGGGACGCAGTTCTACCGAAGGTTTG
GCCATTAACCTACCTACTGTACATAGATTCCTATCGCGCGAGATACTGTGACGATCTCATCTCACGTTTCTCTTTCCTGGACAGCGGAGGTGATCTCGTC
GGTCGCCTTTGATCCAACAGGGAAACGTCTTGCAGTTGGGAACAAAGGCGGTCGTATCGCCATTTATTCCCGACGAGAAGCACATTCTTCGGTCTGTCTA
ACCACCGCAACGGTAAATTAGTGCTGATttgctgacgttgcagtGTAAACGTGGTGGCACAGAACCAGATTCCACACGCTTCGACGTATGCTCCTTTCGC
CGAGTTCCAAAGCCACAGTGCGGAGTTCGACTACCTCAAAAGCCTCGAAGTCGAGGAAAAGATCAACCAGATCAAGTGGTGTCAACCTTCCAATGGATCC
CAGTGTCTGCTGTCCACCAACGATAAAACGATTAAACTCTGGAAGATACACGAGCATGCCGTCTGTCAGGTAACGACGTACAACGAGCAGGGACTCTCTC
ATGTTCCACACGAACGGATCACGTCGGAGCAAATTCGCTTGCCTCAAGCCGAAATTCGCAGCAAGACGATGGCTTCTACCATTAAACGAGTTTACGCCAA
CGCGCACACGTACCACATCAACTCAATCGCCATCAACAGCGACGGAGAGACGTTCATGTCGGCAGACGATCTCCGTGTCAACTTGTGGAGTCTTGGCGTC
TCGAATCAAAGTTTCAGTGCGTATTTAGCACGACAAGTGCGATTGATGATAACAGCACTTGCTAATGACTTGTCAATTATGATTTGCAGATATCGTGGAC
ATCAAGCCAGCCAACATGGAAGAACTTACCGAGGTCATCACAGCTGCGGACTTTCATCCGACACATTGCAACACGATGATGTATAGTACCAGTCGCGGTG
CTATTAAGCTCGGAGACATGCGGCAGTCAGCATTGTGTGACGCATACTCTCAAGGTGCGTACACTGTCTGATTGTGCAGAATGAGTCACCTCATTTTACA
TCTTGCAATGGTATAATAACTGAGATTTGTTTCTTGTTTACTTTGGTTCTGTGCAGTTtttgaagagcaggaggaccCTGAAGctcgaagcttcttctca
gAAATCATTGCGTCCATCTCCGATATCAAGTTCTCACCTGACGGTCGCTACATCATTGCTCGCGACTTCCTCACACTGAAAGTATGGGACATCAACATGA
ACTCGCGTCCAGTTCAGACGATCAATGTAAGGAGCTATCTGTGTGATACGAACCGTTTTTTTTCCATTGCTAACGTATTGCGGTTCTCTATGGTTTGTTT
TATTTCTTCAATTGCAGATCCACGAACACCTTCGTCCACGGCTGGGAGATCTCTACGAAAGTGATTGCATTTTCGACAAATTCGAATGCGCAGTCAGCGG
GGACggcaacaacttcatcacgGGCTCGTACAACAGCGAGTTCCATATTTATGACCGCTATGGACGCGCCGATATCTCCATCACACCGCGTACAGCGCGT
GTGAGTCGACGCCGTTCCATGCCACAGCGCGGTCTTGCGCAGCAAATAGCTGCGATGTCTGATCCAGGAGACCAGGACGCGTTGGATTTCTCGAGGAAGA
TCATGCAGACGAGCTGGCATCCGTCGCTAAATGAAGTGGCTGTGTCTGTCCGCAACAGCCTCTTCGTATATGGTGCCTAAGTGAGTgagtgctggtggac
gcGTGTGCTGCTAAGGTTACAATGTGGGAGCCATAGCAAGTATTCGGAGATTGAAGTTTCGACCCGAACGCCAACATCGCGCAACAGCTATAACCTGGAT
AGTGAAGTCGAAGTGATGCATTTTATAGTGTCATTAAGCTATGCATATCGTATGAGGATCATTGTGAAACTTCCTATTATTTCTTGTTCTACTTCCGAAG
TAAAACTTAGTGGGTTCGCATTAGAAGTTCTTCACAGTAAGAAACACTACCACTATAGACCTCAAGTTAATTGATTCTTTTCCGCAGCAGGCTTTACTAC
AGACTTTCCTTTTGCGAATCCCGTGCCAACGCCAAAGTCCAATAGATCATGTCAGAATggccttgaactcgtcgaacTCGATCTCGCCGCTTCCATCCAC
ATCCAGCTTGTTGATCATCTCCTCGATATTAATGGTAAGACCGAAATCGCCTTTGATTATTTTCACCAATGTCTCCTTGCGCACGAATCCAGTTTTGTCT
GGCTTACCACCGCATGCAACAAATGCGTCAACTGGGGAAATTAAAATATGTTAATTATTAGGAATAAATTGAGAAATACAAAGTGCATGTTGTACTTACT
CATGTCACTATCATCTTCAAACATGGCGGCACGATCCTTTTGGTTATCGATGACCTGCAGAAATTCCGCAAAGTCTAACGGACACTGTGAACCTTCCGCA
TCCTTACAAAACTCACTGATAAACACAGATACCTATTGCTCCACTCATATCCTCGTCAACCTCGCTGATCATCTGGAACAATTCTTCCTCGGTTGGTTGC
TGCCCCATTGCTAACGCATGCCGGCTGGTTAAATCGAGACTTTGCAGAACAGAAAATGTTTATACCTTCGAGCACCTGCCGCAGTTCCCAGACATCGATT
GTGCCACTCCTGGCAATAACTCAGGGCTCGTGACCTTAATACTCGCAAATTCGTGTGCAGCTCGCTTACCGGTCCTTGTCGAAGGCCAGGAATGCCTCTC
GGCAAGCATCGATCTCATCTTGTGCAAGTACCATCGCGACTTCACAGCCTCAGTTGTACGACCCTTCACAGAACTCCAAAAATGTGCCAAGAAATTGTCG
AAATCTGAATTGCATTCTTCACCTCGACTTATCCACACAGTACCACCCCATCGCCTCATTTAGATAGTGCGTGCCCCGAGCACTTGCTGCGGCTGAAGTC
CGATAGGGATAATGTTGTGCAGCAGGTAGTTCTCATTGTTTGCATCCACATGTGCCAAGTCATACTTGTAGTTGATCATCATCCCGGCGCTCTGAGCAAG
TCCCTAGTTAATGCAAAATAATCCGGTGAGTACCCTCAATACAACGCAAATGTCATACTTGCAGGCTAATCCACATGTACAGTACGCACGCACCTTCTTG
GACAAATCTGCCAGCCAGTTGATCCGCTCAAAGATCGCTCCATTCCGGACATGGAAATTCGTAACGGGATCCAACGCTTTTCCGCGCTTCTTTTCATGGT
AGATATAGCGCGCGCCAAGACGAAGCATGATGGGCTTCAACGCCGCGGTCAGTGCCGCATCTTCGCTCCACTCGTTGATCGAAAGCGCGTCTAGAACGAT
GGCCACAGGTGTCGAATCCGAGTGAACGGCAGTGCCACGCTCATCGAGGACGTCGAGTAAAGCATCCAGCTCAAGCGGAGAGACTAACGATTCATTCGTC
TTTGATCGCTGGGTTTCGAGCCACGGTATGAATTGGGGTAGAGGGCTCAAGGTCGCAAATGTTTTCAGATGCGGGTACTCTGTCTTTAGTGCTTTTGCAA
CCTCTTTGATGAGAAAGTTGCCCAAATCCACACCCTGTCGAAAATCAAAAGAAATGGTTAGTTATCTTACCGAGAATGGTCGATCCGAGAAACTATACCG
AAAGTCCCTTCTGCGTCGAAGAGATTGAGTAGAAGAttgcagcttttgcttgGCCAGTTTCTCCCAATTGCTCCGTTTCCTCACGGATTGACTGCATGCT
AGACGCGATCTCTTGCATTAATGCCACATGCACAAAAACCAAGGGTTCGTCCGGGATACTACAAGAGCGCACATTCAGGAAATCAGGCTTTGGAGTTGCA
CTATGGGTAATTGCAGAACTATTACCTTGGATGAAAGAACGCGAAGCAACGGCGCCCATTACCTGATAATAACGAAGACCAACTATATTAGCACCCTCAA
ACTGCACGCGTAATTGAGCCCAAGCTTGCCTAGTCGTCTCTTCAGCTCAGCAATCGTGCCAACTGGGTGCACTGCCTCGTAGCGAatgatcttctccaag
aGTTGTCCAGGGGAGTGTTCATAGGTCACACGTTCCAGTTTCAAGAAACCAACGCTAAACCAGGACGCTAGAAAATGCTTTTGAGAAGCAATAAACGATG
TCAAACGCTAGCAATAGATGTCGAACCATATCAGACTCTACAACGCACTTTCAAGCTTGCATCGAGTGAGCGAAGCGCAGGGATCTCGGAATGAGTCGCG
CTCTTGCGTAGAACTTGCAGTAGATCCGCCCTCATGTGCACCAAGAACAACATGCCATTTTCTCGTTGCGacaggatctgctggaaaAAGGTCTACGTCG
GAAAAAGGGGGAGCGTCAAAGTTACCAGCACGACCCACTAGCAAGCTCCAAATTTGTTCATTACCTCATACAGTGGTGATAGTGCGTTGCGAAGGTTTCG
GAACGTGCGCAAGTATCTCTCCACACTCTCGTGATCCCAATCCACATGTCCGCTGCGAGCGTCTTTCACGTTGGCCATGTTTTGCTTGAATTGAGCGGCA
CTTTGCAGAgcctacatgtagtagtCATCGCAAACAATAATTACTACTGAAGTTGCAACACAAGGCAGCATAGTTTACCCACCGCCACTGTGTCAATGTG
CAAGTCCTGTGCCAATATCTGCAGAAATTGCTTCTTTTCATCAATGTTCATGGCTCTGTACGTCGTACAGAGGCTCTCAATCACCACCTGCGGCACAAAA
TCTGCCTCAAACAACGTCCTAAATGAGCACAACGTCCCTCTTTTATTCTGCATCATCGCCATTCCGCACCGCCCGTATTGGCCTTCGTCTTGACCACCTC
CTGGATCAACTTGGACAGCTTCCGCTGCGCCACAGGACTGCTCAGGTCAACACTGCGCAGAAACGAGGACTGCTGACGGTGGTGCGTTGGCTCTTCGTGT
CGCTTCGAAGGAGATCGACCGTCTCCATTCTCGCTGTTGGTAGTCAAAAACGCACACTGTATCGCGCTCGTCGGCCGCGGGACTTGTCGACAAGACGCAC
CTGCAGCTACTACTCCGCGTATGTTGCGCTGGAGCGCTCCACGCGCCGCCCAGAGGCCGCGCACCGGCACCCAAGACATCGtctcgtcgctcttcaagTG
GCAGATGTGGGACAGTCCTACGAAACGCCGTGTCCGATTTGACCTGTCGTGTTTAGTGTGCACTACACAAATGGATTTTGATTTGACATCGCTACAGTCG
TATTATTATCGCTTGAGTTGCCTCCTGTCTCTCTCCATGATGCTGCGCAGTGGAATGAGGTACTTATACGTGGTGCAAGGCGCGACGCAGTGCGGCATCT
TCCCTTGTTCGACTGCGCGCGTACTCGTGTCTCGGCCCCTGTCTTCTCTGGCTCCTAACAGCAGCGTGCACCgcgtctcttcttcatcgtggcGTCAAGC
TCCGCCACATGCCGTCACTGCGTCGCGTCGTGTACTGGGCTTCCCGtggccttcgtcgtcgtttATTGTGAGTCGCAGTGCTAACTGCCGCCTCTGGTCC
AGTGGTAGGGCGTCCGAGGACTCGAAGGAGACGGCACCGCTCACAGGAGGAGGccgcacgtcgtcgtctccatctccagccaAGGTAAAGGATCTTCAGA
GCTGTAGCAGGCTCGCGATTTACCTGACTGATTGTGTTAATATTGAACTACCTACGTATGACTACAGAGCGACGAAGATTTGTACAAGGAGTTGGAACAG
CCCACGGGGGAGCCCCAACCGCAATCGTGGCGCCAACGAGCCAAGACCTTCGCCATCCAGTACGGCCGTGTAGGCATTTGTACGCACATTGTTCTGTCTC
TCCTATCCTTCTCCGTCATTTATGTGGGGGTATCGAGTGGAGTGGATGTGACTTCTATCTTGGACTCAGTGGGGTTATCTTCGTCGGTCAGcgactccac
caccaactCAGCGGGATCTCTCCTCATCGCCTATACGCTctacaaggtgctggctcCAATACGGTGGCCGTTGACATTTGCTGTTACACCTGTGGTTCTA
CGTGCACTGAGGCGCAGGGGGTACATGCTAGCTGCTACCAACTCGTCTGCTCGAAGCCCACCACCGCCAACACAGTAACAGCCTGCCTGATAATGTTCTG
CTTCTGACGAATGCTGCAGAGATCCTGGAGTTCTCTTGGCGCGTATATGCAATAAAGATGGTCTGAATCCCACACAAGTGGTCTTATTCATTAGAAGTAG
ATTTTGCACCAGCTTAGCTGCTCCAACGACACATTTTTATCGATTGGCTTGCGAATCGATTCTCCGTCCTTACTGTGTGCTACACTTAACTTGtctgctg
cacgtgctcctcAAACACAGGGCGGGCCCCCTTGATGTTCAGTTGAATCGTCGCCGGCTCTGCGCGATCACGAGGAAAAACCACAATGTAAGCAACAACA
AACGAACCACGCGGGTGCCTGCCATAAACTACTTACGAATCGAGTCGTCCGACATGATAATCATGATGTACGTGTTGgcagtgaagaagtcgatgaAGGC
CGTAAAGTTCGAGTTGCGCACTTCCATGCCCTGAAACTGCGCCTGcgttttgctgcagctcagcttgaactgcttgatGATGTTGCTGATCTTTTCAAAG
CGGTGGATATCACGGTGGTTTGTGTGTGTAGCGTGTGAGATAACGAGGAAGGTCGCACGCTCAAACAGCACAACTTCATCAGCGCTacagatcgagcaga
agctgttcagGTGCTTTTCCAGGTCCTGCATGTTCGGGATCAGCGAATACACGATGGACGACCATGCGCGATACAGCGTTTCGTCCCAAATGGACGTGCC
AAAGCACACAGTTGGTAGCTGGCCCGTGCGCTCCAAGatcatctccttcttttGGTTGAACACCTGCAGAGTGTACAGTTGTTTAGCCAGTTATCACTTC
AAAAGAGGCATCTTCCGTCACGTACGCGCTCACGCTGGTCCTCCGGCACCAAATCCATCTTGTGGATCAGCACGAACACCTTCGCGTTACTCGAGTTTTG
GTCGATCGCTTCCAGGCAGCCATCGAAGTGAGCCATGTCTTTCTGTAGGGGGACAGTCAAGACGGAATCAGTATCGCCATGTTCAATTTTTCAACTATCA
GTAAATCGTACGTCAATTTCGCGACTTTCGATATCGAACACATAgatcagcagctccacacTGCGGAAAATGTGGTCGCGTTGGCTCTCAAAGTAGTTCT
CGTAGAAGGCATCCTGGCTTCAAGCACCACAGCACACACCACCGTCAGCTCAACCATTAAACATATCAGCAAAAGAGCTTTCTCCTGTTGCCTTACCCGC
CACAATCCCACAGATTCAGCACTAGATTGCCTAAGAAACGCACGTGCGAATGCTCCACATCCACTACAAGCAGTAGCAACCACAGTCCAGTGAATCATCT
TGTAAGCGTACAATAAGACTCGCAACATTTTCCTCAATCACGTACGCGTGGGCCCCAGTCGCATCGTGTCACGAGCTGGTAATAAACACAGAGAGATTAG
GGGGATATGGTTACTAAGAGGCCCGTTGAGTAGCCACAGCATCAGAGGACTCAGTACCCAGGTAGTTGGCGAAGATAATGGAGCGCATGGACGTCTTGCC
TGAGCCAGACTTGCCCATCAACAGAACCTGTAGGCAACAGAAGCCTCTTAGGTGAGTATACACCTCATTGAGACGGCGTGTTGGAGGGAGACGCAGTCTA
GAGACgcactttcttcttcatggtggcgGCTGGATAGATAGGTCCTACAGATGAAATTCCCgaatgaagaaaaaaaaagcttttttttctAATCAGGGTT
TATGGGTTTCGCCACTGTTAAATTGAAATATTCAATTTATTTCAATTGCAAAATTGCAATAATGTCGCCACTATTAAATTGAAATATTCAATTTATTTCA
ATTGCAAAATAGCAATAACGTAGGTTGCTTCCTCGACGTACTGGATCTCGCCTTGAGGGCTCACTCACACCACGTGCCGGTTTCTCGGCAAACAGTCGAA
CGCCACTACGTGGCGTAGTGCTCCGAAGTCCCAGAGGTGCTCCTTTGGAGTCCTTAGAGATGGTCACTAttcgtaggcctataacgtcagtaatctgacg
ggtctcctcgacgaagggTATTAAAAGAAGGCAGGAGAATGGGAACGGCTCCATCACTACAATGTTGAGCCTGACTTCCAAGcctcgagctccatcgtct
tcttctcgtcctggcAGTGCGCCAGCAACAGTCGCCAAGCGGCGGTGGAATGCGCCACCTGCAAACCTCTTTCCTTCGACAGCGACcccacgagcagcag
ccaagaaatctgcaacaacagctctTCCTCATGTGTCAGCAACTCGACCAGTACCACAGGATCCTAGAGAGCAGTTCCGCGCTGCTATTGCCGCTAACCC
ACCCAGTGCAGAACGTAGAGCTAGCAAGAGagacgcgctgcagcaaagcCGCGTCCAACAGTGTGAAGACGttcaagttccagcagcagattcgcAAGGT
GCTGTAGCAAGCCCTCCAACAgggcgaagaagctcacagTCAGCACGGATTCGTCGCAGTAGCACCGGATACCAACACACTGGTGCTGTCGAACTACCAG
AAAGAGTAGGCAGTGTTACTGCTGCCCCCTCCCTCCATGCTGACCCGAAGAGGCAGCAGCTATTGGCACGAGAAGCGGAAGTCAATGCCATGCAGAGCGA
CCGCAGACGAGATTCCTTCCAAAGCGCGCAGGTCCTCAAGAGCCTTCGACGTCAAGACGTTGAGGCGGACGATGTGAGTCCATTGATTGAAATCATTTAC
TGGTCCCCCTTCGTAGAAGTCCGtcgtgacgctgctgctgccattgccTCTCTGAGCCGCAACGGTACATTGTTTTCAGCGCATCTGGTAGTGAAGTGTT
TATCTAACTTGTGTGTTCTTTATGAAATAGCGGCGAAtctggagctcttggatgAAGTAGGCACACTCGGAGCGATTCTGACAATGTTGAGCTCCCCAGT
AGATCGAGAGGACTCCAGCATCTCCCACGACTGTGCCGAAGCACTGGCGGCTCTTGTGCGACTGTCCAGCatcaagcagaagcttctcctAGCTCCAGGT
GGAATAGATTGTGTGTTCTCGTTACTGCACACGACAACCGATTCCAAGTTGCGTGTGGCAGGTTTCGAGATCGTCTCTCGACTGGTGGCAGCTGACGAGT
GGAAAGAAGCAGTCGCCAAACGCGAAGGCTTTGCGTTCATATTGAATTGCTGTTCCGGCAGTGGCGCACCGCAAACATCTCGGGCTGATGCAGGCGATAC
TCGTACACGAACGTTGGCGGCCTCAGTACTCCACCAGCTCGCTGCCTCATGCGATAACAGACTACTGTTTTATTATTCAGGTCACTTTACGACACTGTCG
GGGCTGCTCCGAGACCCCTTTCTGGATAAAGACGCCATCTTCCGCCGTGAGTTGCTGAGTTTTGTGCACTTGTTGCTCTCCGAGACAGAAAATGCTCGAC
GGTTTGCTTCAATTGGGCTCTTACCGTGTgtacttggcgttcttggtcGCGGATCATCCAGCACCGCGAAACCTTCGCTTCAAGTGAGTTTGCTCGTCGT
AGCCATTATTGATGCTGTCGCGAAGGACGACGTTAATCACCAAGCGCTCGTGCAAGCAGAAACGATGCCGCGTCTTGTTCAGCTGTGCTTTTCTTCCAAC
GCGGGCGTGCCAGTCGCTGATCCCGATAGAAAACGCCCACACACAGCGCGAGTTCAGTCCAAAGGTTTATCCGCACGCCCTAGATCAGCTTCGTCTACTC
GCTCCCGCTTGCGTTCATCGACCTGGTCAGCTTCAGAGGCGTCTGCGGTGATTCGCGCAACACTTGGGATTTTCTGTTCCATGGCGAGGAATCAAGCGAA
TCGGGAGCACGTCATTCGATCCAAAGTGCTGGATCACATCGCAGTTCAAGAGCTGTACGCTTCGTCTGATAAGCGCGTTCGTCGTGCTGTAATCACTCTG
CTCACTCTGCTCATTTGCACCGAGCGCAAGCGTCGTCACGAGGCTGCGAAGGCCACGAGTATCGAACTTGAGCTGTCTACGAGCGCACCTGCACCTTCGT
CCGATTCAAACGAAGCTTCCGAGCACGATTACCAGCACTACATCGAGCTCCTGGCGCGTGGCGTCGTCAAGTGTTTGTTCGGCATCCTTGCCGGCGATGA
CTTCGGCATGAAAGTGGATGCGCTGGGTGCTCTGGCTCAACTCACTCATGACGCACCGTCCCGACTGACGCTATGCAAACCGGCGTTACTGTCAGCATTG
GGGCAGTTCGCATTCCACCCGCTCGGTTCCACGCGGCTCCATGTAGCTCAGATCATCGCTAACTTTGCCGAGCGGCCGGAGAATGTGTTGAAGCTTGTGG
ATGCAGGACTCTTGCTGGTCCTGGTAAGGTATGTAAGTCCTCTGGATCGAACTCATACCGTTGGCCATAGCAGTGACAAAGGTATGGGTGAGGCTTTGCT
GATTGAGGCCACTCGAGCGCTTGCAGCTGTGTCCGAGCTGCACGTAGCACGCTCGAGACTAGTGGAGAGTGGAGTGTTGGGTGCACTGATGCGGTTGATT
CGAGCGCCATCAAATCGACTGGAGGTCCGATCCTACGCCCAGTCCGCAGTGCGCAACTTGCGGCacgatgcagcagcgttaCGAATTCAGGCTATTTACC
GTGGCTGGCATGTTCGCACCACTTTCGCTGGTTCAAAACGCAAGCAGAACTTCCGCAAACTGTCCATGCTGGTAGACGCAGCAACCTCGCCCATAAAACA
ACGTTAGAAGTGTTATCTCGTACAGAACCAAGATGCTTTATCATTGCGCTTGATTAACGCTGTTAGCACTGCGTCTTACGCCTTGTACACGCGCGTTTTC
ACGGGGAAACGTACATCGATGAGTCCGGTGATGCCCGCCGTAAGCACCTGTAGCCACCAATAGTAGACATGCTTAGATAAATATCAAAGTGGTAATGTGT
GTCTTCAGAAACGTACGCTGCCAGCGGGCACCGGACCAACACCTTCCGGGGTTCCAGTGATGATGAggtcgccttcttccagtgtCATGATGCGGCTCAC
GTAGGAGATGAGGAACGGGACATTGTGCACCATATCACTCGTGTTGCCATTCTGACGgagttcgtcgtccaccttcAGCCATAGATTCAGGTCATGGGGC
GACGGCACATCCGACTTGGGGATGAAGTCGCTGATAGGCGTGAAGGTGTCCAGTCCCTTGGCGTGCGTCCACGGCAGTcccgccttcttggcctttgTCT
GCAGATCTCGTGCCGTCATGTCGATCGCCAACGCCTGTCAAAACAGTGGCAAAGTGTCAGTaccagttgcagcaacttcaggGTGAAACTTACGTATCCG
GCCACGTGCTCCATGCTCTCTCTCTCGGTGATATCCTTTCCACCCTTGCCAATTACCACCTGCACGACAAAACACAGTAGTTAGCACCCCCATCGGCCCT
TAATTCTGAGTAGACGGACGTACACCAAGCTCCACTTCGTGATGCACTTCGCCGATTCCAGGGGGCAGCAACACACTGCCTCCGTTGCGCACGTAGCTAT
TCGATCGCAGTTGCATCATTAATTACGGTATATTGTCTTCAATAGTAGTACTATTACCTGCTGGTGGGCTTGAGGAAGAGCACGGGGTCTTTCGGGGCGG
AGGCAGCGCCCATTTCACGCGCATGGGCCTCGTAGTTCTTCCCGATcgccacgatcttcttgctAAAGGGAAAGAGACAGCATCAGTCCATCACAGAAGA
GCAACGAAGAGCAAGAGGTTGAGCTGAAGGCGACGCCGCAACGCACCCGAACTCGACGAactgcttggccttcgtCATGGTAAAAGATATTTGATACATC
ACGTTGATTACCTCGATTTAATGACTAGTTTGGCACTCTTTTGAGATAGGCGAGTTGCGCTAGTCTGCGGTCTGCATGGCTCGCATTCTTTCTTGCAGCG
CTTTGGTCTCGAGTTGCACGCGCCGCCGCTCAGCATCCAAGAGCTCTTCGTAGCTAGAGCTTATAAATGCACAATGAAGGTTAGTTCTTACTTCAGTGCA
CATTAATTAAAACGACGTACGGTGAAGAGTGCGACCGTGGTctggatgacgaagacacTAGAGGAGATCTACTCACTGCTAGAACATCACACAGCAATAA
GTATAAAACGCTATGCTATAAAATATGCTGTTCTTACCGCTGGATGGGATGGACGCTTCCGAAATGGCTTGTAGTTTCTCCGAGTCCACATCGTCGCTGT
TAAGAAATACTGCAGTTCTGGATCTCTCTTGGTCGATTCGCTCTTTGTttctccgagctgctgcctgtggATTTAGCAAGAGTTAGGCCCTGCACTTGCG
ATTGAATAGCAACCCCGGCCAACGTAGCCACACCTggttctcgaagaagagttGTCGGACGTGGTCTGCTCCTGACTGGATTGGTTTTGGTGGCATCACG
ACGTGGCAGTCCGCTGCTACAACCGGTAGTTCGTTCGAGACTTTACTGCTGTCGTGGTTGCGTTGGTGGTAAGGAAATGAGGACACAATCTCGAACGAAG
TGTGGGTATTGAGGGTGGTAATTCTGGTAGCAAAGTGCTCGAGAACCATCGGTTGGTGTGAAGTCGCGACGCTAACCAGTTGCATCATGTGATGCTGAAC
CGCGTCGGACTTCAAGATGTCGAGCAAGCTTGGTCGTTTCTACAAGCAATTGACAAATGAGAGCTCAAGGTTTGGCAAACACGTGGATATCACCTTCGTA
CGTATGGgtctttctccagcagatccgccACTAAAGCTTGGAACGGTGAAGAGTACTGCCCTAATATCGGCGGTGGCTCGCTGTGCAAAATCTTACCCAC
CACAGCACCAAGCGCCGAGCCAGTGAACGGTGGAGAAAAAGTAGCGAGCTCGTACAGGACACAACCAAGACTCCACACGTCGCTTTTGCAGTCATAGTGG
TCGCCTTCTAGTAGTTCGGGCGCCCTGCAGGCACGAGTGGTCCATTAGAAACAAGAAGCGCGGTGCAAACCGAACTTACATGTAGTGCGGAGTTCCGGTG
ATAGTTTGAGCAGAGTCCAGCGTGTTCTGCAACATCTTTGAGACGCCGAAGTCGCTCAGTTTTACGATCCCGTCACCGTCTAGCATGATGTTCTGCATGC
AAGCTCGTAGTGTGGTTAGAACTTCAACGTTCTAACTTCTAACTTAGCAGTCATATCGCCAGGACCTTTGGTTTGAGGTCTCTACAACATGATCAAAGCA
AACGTTGAGTGGGGTGGATCGACAATGAAATGAGGTGCTGCGTTTGCTTACCGGTGCAAAATATGTTTTCCAAGCAAGTATTGAAGCGCCAAGACGATCT
GGATAAAAATCCGCATGATCGCTGGTTCGCTTAGGGGATCTCTGCAGTCAGCAAAAGATCAGCACGAAACAAAAAGTACTATTGCCAGAGGGGCCAGGTT
TCTTACGCGCGCTCTTGTCTCCACCGCAAGAGCGCGTCGAGATCTCCACCGCTGGCGTACTCCATCACAAGTGTCAAATGCGTGTCATCCTCGATGAGCT
CGATGAATTGCACGATATTCACGTGGTGCAAGTGTTTGAGTAGCTGGGCCTCGtggcgagctgcttgtcgcgCAGCGTTATCCTCGCTGTGCGGGGTTTT
AGCGGCGAACAGCTTTCGATCTGCGTTTCGCCGGACAAGCAGCACTTTACCGAACTGCCCACTGCCAAGCACCGTTAGAGTTTCATACCCATTCACTCGC
ATGCTGTggcgtcttcactgtcaaTCGAAGGAGTTAGAAGTCGTTACTGGACTAGTCAAAGCTAAGAATTCTTTGTAGGAACAGACAGCGTGCCTGCCGC
TACTGTTTCATTTGATCTGGTTTAGTGTACATGCACGTATCGTTGCTCTATTAGCTTGACGTTATCGGGAAAAAAATGTCGTGTCTTCTGCCTTGCTTAT
CCTAGTGACCTTGCTGTAAGGGAGGCAGCAAAAGTGAGGACTCCATGGTCACTTACTCCCATTCGATGGTGGCAGGCGGCTTGGACGAGATGTCGTACAC
GACGCGGTTCACGCCACGAACCTCGTTGATGATGCGGTTCGACATGCGGCCAAGCACCTCGTACGGCATGTGGTACCAGTCGGCAGTCATGTAGTCCGAG
GTGCTGACGGCACGGATGGCAACAACCTTCTCGTACGTGCGGCCGTCGCCCATGACACCCACAGACTTGACCGGCAGCAGGACGCAGAAGGCCTGACCCG
TGGTCTTGTAGTGGCCACtgttgcgcagctcctcaatGAAGATGGAGTCAGCGTGACGAAGAGTCTCTAGCGCCTCAGGCGTGATCTCGCCGAGCACACG
GATGGCAAGGCCCGGGCCGGGGAACGGGTGGCGCCACACGCTGGGCTCATCGATGCCAAGCGCCATTCCGAGCTCACGGACCTCGTCCTTAAACAGCTCA
CGGAGCGGCTCAATGAGCTTCAAGTGCATCTTCTCGGGAAGGCCACCGACGTTGTGGTGGGTCTTGATCGTGGCCGAAGGTCCCTTGTACGAGATACTTT
CGATGACGTCCGGGTACAGGGTGCcctgcagcaggaagtcCACGGGGTGTCCGATGCGCTCAGCCTCCtcctggaagagctcaatGAAGAGGTTGCCGAT
CGTCTTGCGCTTGGTCTCGGGCTCAGTGACGCCCTTCAGAGCAGCCAGGAAGCGGTCCGAAGCGTTAATGCACTTGAGGTTGATGCCGAGCTTGGTCTGA
AGGCGCTCAACAACCTCCGTGGCCTCGTCCTTGCGCAGAAGACCATTGTCGATCAGGACGGCGTGGAAGCGGTCGCCCAgagcgcgctgcagcagcacag
cagcgacagacgAGTCAACACCGCCGCTGACAGCACCAATGACATGGCCCTCGGGTCCGACGGTCTCGCGCACCTCCTCGATGAAGGCGTCGGCGATGCT
GCGCATGTCCCAGTCCGTGGGCGAGTCACAGATGTTGACCACGAAGTTGCGCAGGATGTCCTTGCCGCGCGGGCTGTGGGTCACCTCAGGGTGGAACTGG
ATACCGTAGAACCGACGGGCCACGTTGACAATGGCAGCGTGCTCCGAGTTCTCGGTGGTGGCGATGTCCACGAATCCGTCCGGGTTCTGGTGCAGCTTGT
CGCCGTGGCTCATCCACATCTGGAACTCGTCCGGGAGGCCCTCGAACAGGCCGCCGCAGTCCACACCGCTCTTGCGGGTCACAATGGCCTTGCCGTACTC
ACGGTGCTGTGAGGGGGCCACCTCGCCATTGTTGGTGAAggccagctcctgcagacCGTAGCAGATGCCGAGCACgggcagcttctgctcctcgaTGAGC
TTCCACACCTCCGGGTGCACGTGCGGGGCGCCCTTGTCAAAGACGGATTGCGGGCCACCCGACAGGATAATTCCGgtgagctggtgctggcgcagctCGT
CGGCACTCACTAGGCACGAGTAGAGCTCGCAGAACACGTGCAGCTCGCGTACACGACGCGCAATCAGGTGGCTGTACTGCGAGCCGAAGTCCAGGATAGC
CACCTGCTTGCGGTTGGTCACTGGGGAGGCGTCGGCCATGTTGAACGGGGTCGGATCGAGTGTTCGGCGTGTTCGGTTCTGGCCAAGCGAGCGCCTCACA
GCCACGGACACGGTTGAACTCCTGACGTACCAGCCAGCCACTTGCAGCCAATCAGCAGTCAGATCGTTatttgtagccatctcgtAGACCAATCACAGCT
CTCAATCCGAAACGACGCGCAACCCTACTAAGCTCGAGGacgcactgcaacttgctgcagtcaGTGCAGCGATGCCCAGCGAGGACACGCGCGGGTTCTG
tagcagcacgagcgtctccaaTTGACTCGAAGCCAATGCCGGAGCCACATATCCCAGCACACCGCGGTCTGACAGAAAGTTGCGACTCAAAGCCAGTACG
CGCAATGGACTTCCGGATAACAGAGCTCTTGCTAGAGATGGACATGCAGCGTCGGAGATGTGGTTCCCACTGAGATCGAGCTTCCACAGCGCTCGGTTGT
AACTCAGGGCCTCGAacaatgcagcagcaccggcacTGCCCACTTGACAACGCTCGAGCACCAGTTGTTgcaagcagcttggactTTGGGCCAACGCACA
GGCAAGAGCCACAATGGAGGAAGGAGCCAGAGGGACATTAGCCAGCACGACCGACACGAGCGCGAGGCTGGAACTCCGGCGGCTGCGCTGCAATATGGTA
GACAGCAGAGACGCGTGCGATGGTCGGAGTGGTGCGTTGTACAGGATGAGAGACTGGACTGGACACGAGCTGGTAGTGGAGTTGGTGCACATATCCAAAG
CATCGACAACGTGTTCATTGAGGTTCAGGAAAGAGCTTGTAGATGCTGGATTCGTGCTGGGAAGTCCGCCTCCGCTGTCAACAATTACATTGGTTGATAG
TGAAATGAGTTGTCGAAGTTGGGGTCCTTTGAACACGGTGCCACCGCTGAGAATGAATATGTTAAACGTCGGACGGAGTGGAAAAGAGCTATGAAACCAA
CCCATCTACCTGTATGAGAGCTGGCATATCCCTGTTTGACGCACACGGTTGAGAattgtgaagaagagcattGAAGGTATCTCCGCGCGCTAGTCAGAAC
ACGGTCGTGGTGTTAGTGATGCAATTTGCAGGAGAATGACTTCGCTTACCTCTTCGAGCGTCCGAGGCTTCTCGAACTTGCCTCCACCAGCGGTGCCTGG
TTTCCTCTGGCTGCTGACAGGTGTGTTTTCTCTTGACTTGGTTAGCGACGAGCTACGTACACGCAGCACGCACTTCTCAAGTAGAGCCACAGCCTCCCAC
TGGCGGAAGCAACGCTCCAGCGGCTTTTGTGAGGCAGCAGCTAACAGCCTTGCTTGGGCTGCCTTTTTGGCCACTACACAACGTGCTTGCCGTTGCGCTC
GGTGACGACGAAAGGTTCGTTGAAGCAAACAAGCTGCTTCGATCTGCTCTCGTCGATTGGATCGTGCTGCTTCCCTCCAGCCGTAAAACAATCGACGCAC
TCGCTGAAGCGCTAATTTCTTCGCAGCTTTATCACCACGTTGAGCAGCGACCGAATTTCTATCGAGCGTACTGAGGTACCTACGACGCATGAGCCAGCAT
CGCAGTCGCCGTTGAATTTTGGTCGCTGCGTCGTGTCGTCGAGCCTTTTTGGCTTCGCATTCTGCACGAACTGCTCGAAAAAAGATTCGAGCAATGCTGT
AAAagttctgctgcagcctccCCAGTAATCGCCGTTGAGCTGCGCGTTTACTGAGTACACGAAGAGTTCGAGAGCGCTTTTGTCGCTGCCTCCACCATCG
CTGTAGCTGACGTACGGCCGCATTACGCTGGGAAATGTACCTTTGGAGAGCCAACAGACATGCCCAGAGCTTGATGTCCGAGGGTTGATCTTTTAGCCCA
CTGCCGAATGTCATGGTGCCATTTACCAGCATTTCTGCTATATGTCGGCGATGCAGTCTTTGACGAGTGCAAAAGCCTCGGAACAAACCTTGGATGCGTA
TCACAGCTCCATATCTCCGTCGGTGGTaggcttcaacttgttgaCGGAGACGGTCGAAAGTTGCTTGTAAAAGCTGAGATTCACGGGACTGTGTGAGCTT
CACTAGCACATTGAGAGCTCGTCGACGGCGTGCACGAAGTCGCTTAGCTACTCGTCTGGCACTGATACCTCGCACGTGCTTTTGGATTGTCACTGCTGCC
CCCCGTTtgcgaagacgacggacaAGCGCGTGGTTTGTAAGTGCTCGCCAAGAACTCAGCAGCATTTGGTTCCTACGATCTGAGAGCAGGCGGTTCATTG
TAGCAGTTGCCGCTCGATGACGCCGTAGCTCGACATGGTACTGGCGTACTGCTAATCTTGAACGATATCGTCGTTGAATGAGCCGTGAAGCCCATTCCCG
CTCCTTTCGAGCTTCTACAAGCTCAGTCTGCCATGCTTGAAACACCCGAGTGCTTAAAGACGTCGCTCGCCGAGCAAGACACTGTTGTAGAATGCTATTC
TGTTGCtggcgaagcagcaggaactgaAAGCAGAGCTTGCGACTGCACCAGGCTCGGAACTGTCGTTGAATCCGAACAATAGCATCAAGACGCTCCTCTT
TTTGAGTTGAAGCGAAGTCACGCCACCTACGGAACACTCCAAGCTGGCCAAGCTCGGTACGACGGCCAGCAAACTTTGCCAAAAGAGCCTCGCGTTCAAT
TTTCCGTGCTCGAAGAGCCCGTAGTGTGCGTTTGGCTCGGGCGATGTGCAGCAACGATTGAATTTTCCTCGCAGCGGCATTCAGCCACAGCTCAATCAGC
CGGTCATCTTGTTGGCCCATGGTTACATTAGCCAGAGCTTCCTTCTCTCGTTGTTTATCGCGCAAAGATTCAAGCTCCTTTCGCGCATTAAACTGTTTCC
AAGCGCATTGAATTCGGATTGCCATCGTAATACGACGTTGCTCCAGGACATAGGCAACACCGAGGCGCCACTTTGCCAAAATCCAACGTCGCCGAACGAA
AACTTGCAGACGTGCTGCACTTTTGTTCTCCAACGCAAAATGCTTTCGCCAGGTATCGCTGCAGACTTCCAGTAGAAATCGTTCATGTCTGGCAGTGTAA
TAAGCATCACGTGGCAACTCCAAGAGCGCTTCTGCAAACGCTTTCTCGGCTCCCTGGTCGTCTCCCGCGCGCAGTAGACTGGCACCTTCCAAAAGAAGTT
TGGGAGTTGGAAGACTGCCAGACGCTTTTTTTATTCTGCGgcgagcttcacgaagaGCTGACAGAACTAGAAGGGGGGCGTTGGCTGGACCTGCGAGGCG
CTGGGCTAGATCCATCCACGTCTGTGGATCATGGCACCATAGTAATATCCGTTGTTCCTCGTTTTTCCGAGATGTTGTGAACACCGTGCGTGCAGACTTC
TCGGAGGGTAATACTGGTGGAAGTGCAACGAGAGCTTTGTACGCTTGAGTGTACGTCTCACGCTCTAGTGGACGCATCCCTGGAACATGTGAtagctcca
gtgctgccagCAGACCGAATTGGTACGCTGCTAGACGAAACGGGAATGACGAAGATGATCCCTGGCCCTCAGCTAAATACTGGAAGTACTGTGCGCTTTC
ACGGTGACGACCTAGAGCTGTAGCTGTAAGCGCCGACAGGAAGATGGCCTCATTCAGACGTGGAGACGTTGGGTATCCTTCCACCAGCAATGTACAAACG
GCAAGTGCACCCTTGAATGATCCAAATTCAATGTAAAGCCTCGCCAACGGCAGCAGTAGTTCTGGACTCGATTTGCTGTTTGGATATTCCATTGCAATGA
GGAAAGTGCTATACGCCTCTTGCAGGAGCACGGAATGAAGTGGTTTGTCACTGGTATTTGAGCCACCGGATCGCTTCAATTGTGTAGCGGACGAAATCTC
AAGAATGGAAGGCATATGCATCGCCCTGGCATAGGATTCCCATAGTTGGAATTGCGTAAGTGCAAGTTCAGTCCAAAGCTTCTCTGAGTCACCTTCACGC
TATAGGATAAAAAGCGGTTGGTATAAAGAGAATATAGAGGTGAGATCACAGCCACGTACCTCGATGATGTGCTCCAACGCGTCAACGGCATCCTGGTACA
TACCACGACGGCGACTCTGGAGTGCCTCAGCATACGCTGTCTTGGATTCTTCGCTCGAGAACGACAGCCCACCTTCATCTTTACAGGCCGGTATGATTGT
GCGTACACGATTCATCGTTCCGTTGGCGTCACTGCCCAAGCACTCAATGGGGTTTCCTATAATTATGTTTTGTACTGATATAATCCACGATTAGCAAGGA
TCGGCGTCCTGGTTCATTTTGCGCGGTGTGATCCTGACGTTATCAAGCTCACAGACGATTCGAATGCTCTTGCTTCGGATTTCTAGTACTTCTGGCCCTT
GAACATGCGCTTTCACCAGTTTTGCCATTTTCAGAAACAGAACCATGCCTTCAGCGCGTCGAGCAGAGGTACCTCGCGGCAGTCTCTTGCTGTGGTCATC
GAAttccaactgctgctctgtcTTGTTCATGTCACGCTCGAGGGAGCAAAATATGCTACGACATGGTCGTTCTTGATAATGCTGGACGTGCGGGGGTTCT
ATAAATTCCTTGAATTTTTCTACCAGCGAGGACACAAAAAGCGGATCATTAACTGGATTTTTGCTGTCAGCATGGCCAGTGAAGtgttccacgagctccg
aAAGCTTCGAGAAATATAGCTCAAGATGTAAATCTGTGGTGCTCCTGGTAAAAGCAAGCAGTTTTTTCCAGCTCGCATCTGCCCAGTGCAGTGAGCTAAG
AAGTACATCTAGAGCTTTCAGACACGGTTCGTTGAGCATCGATGTAATCGAGATGGATCCCTTCACAATGTCTCCAAGCGAGCCTACACCAGAAAAGAAC
TTTAGTCGTCAACAAGGAATCAGCGAGGGTTCTCTTACCAATTCCGAGCTGACGGATCATCTCTAAAAGCCTCGCAGATTGGTAATTTTCGTACATCCTC
AAGAATTTGTCGAAGGAAATTGTCGAGGCTCCGCTAGAAAACTCCATTAGCGAGACTTCCCGAAATGATTCCTTTCCAATGGCCTGAAGGAATGTATTAA
ACTCCTGCAAGTTCCATTCACCACTCTGATCAGTGTCGAAAGCATCAAAAATCATTTTCATAGCGCGTTCCCGGTTCTTCCTTTTCCCTAGGCTTTTCAG
CAACGTTGCCATGtcttgtgcagcttccacaATATCTGAGAAGGACTGATCCAGCTCACCCAGCACGAAAAAACTCCGTATTCCAGCTGCAAACGACGTC
CCCATGCATTCCTGAATAGTGATGACAGGCAAGTATACAGAGTGAATATGAGCTCTAAACAAAGCAATGAGGACTAGTTTCGTTTACCTCCAGTTGTGAT
ATAACATCTTCGCGGAAGTCAATGCAGACGCGAAGATACTTACCCAGGACAGGCTGTATCCCTCCATCACTACGAATATCGGAATGCATGGTAACTGCAG
CAATGAAACAAGATGACGATCAGCTCGGACAAATGCATTGTGTGGCCTGATCATACTTTTTAGGTGTGTACCTGAACATTTGGCCCACAGCGATGCAAAT
AATGACCACACTTGATCTTGCTGCACTGCCTTCTCTACTGCAGATGCTAGATCAATGCCTTCCTCGTCTGTTTTCAGTAACACAACACCAATTTATCGAC
ACTGAACAGTACAACACATTTAAACAAGACAATAGCG