Description :
From Genome Similarity Track
Location :
Scaffold_3877:407- 1416
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_3877-snap-gene-0.1Myosin

Sequence
1009 bases(100 bases per row)
TGTGCAGCAGAACTGTTCGTGCGCGCCAGGAGGTCTACAGTGTTCCGCTCTCGGCGCTTCAGGCAGGAAACAATCGTGATGCTCTGGCAAAGGAATTGTA
CGCTCGACTATTCGCTTACCTCGTTCGGCGAGTGAACAAGAGTATCTCTGGCTCGGGTTCGATGCGGTCAAGCAAGAAGCCCAGTTACATGCACATCGAC
TTGCTCGATATCTTTGGTTTCGAGTCGTTCAAGCGGAACAGCTTCGAACAGTTCTGCATCAACTTCGCGAATGAGAAGCTTCAGCAAAAATTCACGCTCG
ACGTCTTCAAGACTGTGCAAGAGGAGTACACAAAAGAGCAAGTCGGATGGGAATTCGTGAAGTTCAAGGACAACCAAGACATGCTGGATCTGCTTGAAAA
CTCGATGGGTTTGATGGCACTGCTTAACGAAGAATGCGTTCGACCCATGGGGAGCGATGTATCATTCGCTTCCAAGATTGCATCTTTGCATGATTCGCAC
CCACGGCTGGAGAAGATTCGTGTGAGCCAGACGCAGTTTTTGCTCCACCACTACGCTGGCCCAGTCACTTACGATGCCGAAGGATTCGTCGAGAAAAACC
GTGATTCCCTCCAGTCAGACCTGCTCGATTTACTCTGCAAGAGTAGCAATGGCCTCATCGCGGGCATTTTTGGTGCTCGAGCCAGTGGCTTGTACACGGA
TGATGACCTCGCTGCTGTGTTTGCTGCTGCGACCAGCGACGATGGACGCCGCAGCGCCACGGGACGAAAAACGTCTACTTTCATGCAGGAAACTGTCAGC
TACAAGTTCAAGGCACAGCTTGCACTCCTGATGAGTGACATCTCAGCTACAGAGGTTCATTACGTGCGCTGCATCAAACCGAACTCGAAGAAGAGTCCTC
ACTCGTACGAGATTGACGCTGTTGTGAGTCAGCTTCGGTGCGCTGGTGTCATTGAAGCGATTCGGATCACTCGTGCTGCGTTCCCAAACAAGTTGAGTCA
CGAGAAGTT