Description :
From Genome Similarity Track
Location :
Scaffold_66:406996- 415196
Sequence
8200 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTTTAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCCAGCGCAAGGTGCTGTGTGACCCCCTCACACTTGGTAGCACTCGTAGTCGATCCACGCAACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATCAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGG
GATGGAGACCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATTGCACATGTG
CGGGGGAACTTGCAGGCTCTGGCAGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACC
TTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGCTGCTTTTGCACTCTCCAACCTTAGCGGCCG
TGCTAAGAGTTGGGTGTACACACGGGAAGCAACATCCCCTGGATGTTTCACAGCCTGGACTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCG
AACTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGCGAACTGCACGAGTATGTGCAGGAGATATGGGAGCTCACGGCGTCCC
TAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTTTGGGTGCAGTCAAG
CACCCTTGAAGAGGCGATTCAAGTGGCTCTTCAGAAGAGTACAGCCATAGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGATTCCTTGTCGGCTCC
CGGTCGCACAAGCCCCAACGGACCAGTTCCCATGGAGCTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGAAAGATGGGCCACTTCAAG
CGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAG
GGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTT
CGCACTCTCGAATCGGCGAAGAGCAGCGGCGGATGCTCGTAGTACACGATGTGTACGGGGATACGATCATCCCTTAGATCTTGATTGACTCTGGGGCGNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTCGA
TATGGATCCATTATGATATGATCCTGGGCATGGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTG
CGCAGTCCGACAGAGCATTGGTGAGTCATGATCCCACCTCTGTCAGGCCCCGGGGAGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTT
GGGAGTCGTCGACGTATATGACGACTCCAAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGTCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGT
AACTTAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTG
AAGAGAAGGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTG
TGTGAGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAGCACGCTTCCTGTATGGGTACAACAGTATCACACGAGGCC
ACACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACACCGCCGCCGCCTCAA
GTCGGATACGAACTTCGTTTCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCCCCGACAAGGCCGGTGGAAGATATCAAATCTTCG
ATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCGGAGATACTGAACCTCGAGGAAATGACGGCTGAGTC
TTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCCCCTCTGTCTTGGACGAG
AGCGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCATAGATCCGGTGTATCCTTTGGTGACGGAGTATG
CGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGAATCGAGGCGTACGGAACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAG
GCAATGGCCTCTCCCGCGCGAACAGTGCGAGATCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCG
ACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGGACAACGCAACGGTGCCGGCTTAAATACCGATTC
CACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGA
CATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCTGCAGGGCTTGTCTAACGCCCCGCCGACGTTCAATCGCCTG
GTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGG
TGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGT
TCTCGGTTGCTTCGTCAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCGTGGCCGACGCCCCGATCCCAGAAGGATCTTCGA
AAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGC
GCTGGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGATTCCGTTTAGCGT
CGTCTGCGATGCCTCCGATTACGCCATCGGGTGTTTATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGTCCCGGCAGTTCAAA
GCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTAGGCCCTTTG
TGATCTACACAGACCACGCGTCTTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTCTTCGCGGAATACAACTTC
CGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCGTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACATCGGATC
TATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCCGAACGAGCGCGAAGTCCGACTGGCTCTC
GTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTATTCAAC
GACGAGGATCTGAAGCTCGACATCCTCGCGGAGGCGCATGACGCGCCCCCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCT
TCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATACGTCAAGACATGCGAAACATGTCAGCAGGTCAAACCCGCAGGGCAATCTTCGGCTCCACTACA
GAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGATTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTC
GTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTAAGGGGCGAACAAACCACAAGGTTGTTCGTCGATGGCGTGTTCCGCTATC
ACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTC
CACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGG
TCGTCGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAG
TGCCCCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTC
GCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGACCCAAGATAAACAAGAGGAGTAC
TCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGTGACTTAGTGTTGCTAGACACGAGGAACCCACCTCTAGACACTGTTTGCTCCGTCG
GCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCA
CCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGATCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGG
TCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGTCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACG
GACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCGCCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAA
GCCTCGATCCGTCAGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGTAGGTGCAGGCTCACGACCTCTCGCTCCACCA
GGTCCAGGCGGCCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCGAAGCCAAGTGCAATCTCAAGCACGAG
GACACGTTGACGGAGGCGGTCAACCTCAGGGTCCTGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTAC
TCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAGGCCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGCAAGCGACAG
CTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAAC
AGAAGCGTCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGTCGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAA
GCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCT
GATCTGCATGGAGTTCTCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCTTCACAAGAACTCCACGTGGGACAGTTCTC
GGGCATAACCCAGGGGTATCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTTGC
GCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGAGTGGCCGCCCA
CAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCT
GACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAATTCCTCCTGCTGCTGGTCAAGGTCGTTCGAGACCTCCCGGGGCTCAACGATA
GCACCCTCCTCCTCTTCTTCTTCCTCCTTCTCCTCCTATTCGTCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCGTCTCCTCGCGGAGTG
GAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGG
ATTCTCTTCCCCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCA
CTAGCGGGCGACTGCACGCTGCCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCCTGAGTGCTCTCGGACTCGG
CATCGTCTTCACTGCCCGAGTTGAACTCGCGTTCTACGAACCGAGGGTTCGGACGGTTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCG
CTTGTCCGCAGCCGCGTCACCCGAGGAGCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTGCTCTTG
GCCTGCGCCTTACGGCTGCAGCCTTAGAGCGTGTCTTAGCACCGCTCTTAGTAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTAGACGAAGAG
CGCACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGA
TGAACACCTCTTCATTCAGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGT
GACACTTCACACTTCAGGAGTATGACACGTCATACTCCGAGATATTTGGTACAAGGTACCAAGGTCGTTCAAAGCCAACCATTGGTTAAATGACATTGCA
TTTCTATAGGTAACTAACAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTGGGTCACTTCGCTCTCTT
TAATAAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTTGCGCAAGGTGCTGTGTGACCCCGTCACAT