Description :
From Genome Similarity Track
Location :
Scaffold_558:4067- 9041
Sequence
4974 bases(100 bases per row)
TAATAACGATTGGGCTGGCCCAGAAAGACGTCGAAGGCTGTATAATCTTTGCCGATAACAGCCCCTTGATCAGATCGGCCAACTTCTTCTTAAATTGGGA
AGCCACTTTGCGTACGCGTTGCGCTATCGGCTTCAATTCCTAGATCAGTGTCACGTATATCCCCTCGAGCTACTGGCGGTAACGCCTTCCCTTTCCCCAT
CAACATATGTCGTCTCTTTCAAATGATTTGTCGCAGCCTGTCCACCTCTTCTGGAGTGTTCCCATCCGGATCAGGGATCTGTATATCTTTTAATACAATA
GATTCGGAAGAAGGGTCCACTTCTGGTATGATCGCCCACCCTCGGTTTATGTCTTCTTCCCACAGGTCTCCGCTTTCGAATGTACACACTTGTTCATCGT
CTCGTGGAAATTCGTTGGCCTCAGCTTCCTCTCTTTCTACTGCGATTGCTCCCGGTGGATCGTCTTTGGAGCCACTTCGTACTTGAGGGTTCTCTTCTTC
GCGTGAGTGTTATTTTCTCTGGTGACGGCTGTTGTGACACGTTCATCATTGAGACTGGGGTATTCGACCGCTGCAAAATACGCGACGGGATCTTGTACTG
CGGGGTCTCCACCATTGGTGTCTCGTCTTCCTCCTCGAGGTCAACTTGGGGGTCGACCTGGTCGGTGGTGGCTTCGTACGCCAGGATCAGCCACTCAGCG
TACCTTCGAGAGCCTAACGAGACGTAACCTTGTGCTCTTGGTACTTGATCCTTCGTCAGTCACATATCTATCTTGGTATCATCATGTAATATCAACGTGT
GGAGGCTGACGTTGGTCACTATCAGCAACTGTCAGCGTCCTATCCCCCGGGTCGTAGTTGTAACCCATCGCTCTCCTCTGGTGACCCATATCCTCCATAG
ATCTTATATTGACCTTTTAAGGGGCACCTCCACACATCCACCGGCAATTATACGGGCATATTGTCCCATCTTCACGTATGCGTCTCGATTATCGTAAACG
GTCCTTCGTCCGGAGAGTTGTATCCAGAATTCGTTAGGGAAGACAGAGTGTTCCATCCGCCAGATCCAGCCGGATCCTAGCCGGGACCATGAAATCCATT
CCTAAAATTGCATCCTGAATCACCATAGGGCCTTCCCACACCTTGAACACATACACTAAATTTCCATCTAGGGTAACCTTGATGCGAGTGCGCCCTTCCG
TAGAGTACACCGATTCGCCAATGCACTCTTGTCGTTCGCATTCGTTAATTTGGCAGCCTACCTTACGAGAAAAGGCAACATCCAAAATGGATATCTTGGC
GCCAGTATCAACAAATTTGCACGATCGTTGTTAATCTTCCCAGAGGCTTTGGCTTGTTTAAACCACTTGGTTTGGGAGTGGTATTTCCAGTATCCTCGGG
ATTCCCTAGGCAATAGGTCTAACTCCATTACTGTATTTTACCGGGAGAAATCATTAGGTCGTCGAGAGAGACAACATGGACCATGGGATAGTTTCCAATC
TTCGATATATTAGCGGTCTTCTCTGTAATGGAGCAAATCTTATTCAACTAACTGAATAAACCTTGCACTGCTGACAGTGCAAGGGTGTGTGCGTCCGACT
ACCTCACGTACACGTACGTGCAGAGGAAGATTGCTATACGGAGTAAGAGTACTCAGTAAAGGTAATAAGTAGAACTGTATTTAGTATAGATAATCCCTTT
TAATAAATCCCTATTTGACTTCATTTAACTATTTCTATATACAAACATGTATTGTAACTATCTGCCCACCACTCATTGCGTGCTTCTGTCGTGGCTAGAC
ATTATTGGTTGATATCTCGGTCCTATATCAACCAATGAGCAGTATATTACATCTGCGAAGCAATACTATTTATTAGGATACTATTGTGAGAATATTATGT
TTGTCCTAACATAATATTCATATTTGATAATTACCTTATGTATATTATCATGTAACGGAGGCACCCCGTCACATCACCCCCCCCCTTAACCATCAGTCAC
ATTAGTGACTGATTGACTATTGAATGACTCTTTTGAGTGGCTCTGGGACAGGGAAGCACTTGTTGGCCAATCCATCCATTATCTATTCTCATCGCATGGT
TAACAAGTCCGTGCGGTGTGCAGCCAAAGCTGCTGAGAACGCAGCCATGAGACTCCGCTCTGCTGCCGCAGGGGAGACAAGATCACCCGAAGCAGCTGAC
TTAAGTTCGTCTTCTGCTTCCACGACTCAGCCTGCAGCAGTCGCAGCTGCAGGCACACGCGGTGATGCACCGCGTGACATCAGATATTATGATCTCGAGC
TCAAATACTCTTGCGAGTCAGACGGTGAGACCGACTCGAAGGAGGCGAAAGCCAAGGTTGAGTCAGAATTAGCTAAAGCGGGGCCGACTAAGTCGGTTTC
CAGAAGCGCTATAAGCCTCGCAGAGTGTCGTGACATCTTCGGATCGTCCGACGAGTCAGACCCTCCGTCTCCGAGACGGAATCGTTTGGCTGACAACGAG
GAATGCGGTGGCTTTATCCACCGGGACGATCCTGAAGACAATGCAATCATGCATCAGAGTCCGGGTGATCGGGATGATCATGGTGTCGGTACTTCTGTTG
ACACCAGAAAAGAGACTGAGGATCGCAACATCTTGCGCGTTGCTCCTGAGAAGAAGCCGTGGCTACCTCCTCAGAGAGTGTTAGCTCGTCTGTCTGACAC
GACGAGTGATCGTTATCGAATAAGATTGTTCGATTTATCAAAGCTTCATAAGCTTGATCCTAGTGCGAGTAACTTTCGCACTGAACATGATTTCTTCATC
GATGCGTTCTTTAAGCATCGATGGTACAGTGGGATCACAAGCGTGATGGTTCCTCATTGATTCAGGCATGGAACGCTTTCATCCACAACGTTAGTGAAAT
TGGGCGTGATGCCTGTCTAGACAAGCTATTGCTAGCTCGAAAACGGTTTGAGAAACGGACCTCTACCGGTGCACGTTTCAAACTGTATCGGTTGTCAAGA
GAGGCCGGGCTACCATGCCTCTCTTGGGGTGACGCGTGCCAAAGTTGTGTGAATAACTTGGCACGAGCTCCGAAGGAAGCCTACTCGATGACTGACCCCT
GGTGCAGGGCACGTGTCACTCGAGTGATGTACGAGGGAATAGCTAATTTGCAATCGCTCTACAAGCGCGCTGGGCGTTCGCTCCTCGATGGGCCTTCTTC
GGCATCAGATGCGCCTTGTCATACTGCTCGACAAGGCCCAAAACATCAACCAGCAGTTGAGAGCGAGGCTCCCAACTATATGCCGAGGGTGGGTACCCGC
GCCACCGGACGAGGTAACTCGTCCGACGTCCCTTCTCATCGCGGTGGTTCAACAAGCGCTCCACGAGGAAGCGTTGGCCACCGCGCGCATGGATCAATGG
ATGGGGCGGATGAGGAAACACGTTCTCAGACGGATTTGCAAGTTCAATCAGATACTGTGAGCCAGCTCGAGCGCGTAACGTGTGAGTTGCGCGAGGATAT
CGATCACGAGAGGAGCAGACGTTTGGGTCTGGTCGACAATGTGATACGTCTCTCCTCGTAACGGGAGAGAGATCGATCAGATCTTGCGTTTACTCAGCTT
GAGAACGAACGGACTCAGCATTCTCTTCGCGACGAGCTAGTGGAAGCTCGTCAGGATATCTCTCGGCTTCGCGGGGAGGTATCCGAACTTCAGACTCGGG
CTGATATTCAGCACCGCGAGCACAAGTATCTCTTGGAGATGCTTGAGCGCAATGGATTTCTTTACTGGAAGAAGTCCCGTACTGGTGATAAGGTCTAAGC
CGACCGACGTAGAACGTAGGATGCGTGCGCATCTTATGTGGCAGTTCAATCGTGTATACGTTGCCTAAGCGGCACAGTACACGAAATGGACCGATGAACT
TGGGTAGTAACTATGTGTCAAGGTAAGTTTACCGTAGGTAGTAGGACTAGGTCACCTTCGTTGAATGAAAGAACATTTGCCCTTCTATTCTTGTCAGCGT
TTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAACCGACAACCATTTCGCGAGCCAGTACGAATTCATCTGCTGACTCGCTGTCTTT
GGCTGTAGTGCGCTTGGAGCGCATTGTGGCAAAATCAGTGACCTGGGTAGTAAGAGCATCTTCGCTCTTACTTTCCTCTTCTCCACCGAAGTCGATGTGA
TCGACATCGGCGTCATACGTAGCGACCTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCGTTCGCTCGAATGATTCCCTCTCTCCCTCAAACTAT
AGTTACACTCCAAGAAGGTGGGTAGACTTGGGTGGCGCAAGCCATTCACGAAGAACGGTGTATGCGTCGTCGATGCATGCACCGAGTTGTTGATGGCGAA
TTCCACCATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAACCCCGAATGATTTCCTCAAGAACGCGGTTTGCATGTTCTGTTTGACCATCT
GTTTCAGGATGCTCAAAGGTCGGCATCTGAAGGCGAGTTCCGAGTGTTTTGAACACGAATTGCCAGAATTCAGCAGTGAACCGTGGGTCTCGGTCGGAGA
CGAGTTCACGAGGCAACCCATGAAGACGAAAGATCGTGTCAATAAAAACACGAGTGCATGCCGATGCATTGATAGATTCAGGTACAGCGACCAGGTGTAC
CATTTTACTGAATCTATCAACGAACACAATAATACCGGTATTCTTGTGTGGGTCTGCGGGGAATCCGACGACAAAGTCCATTGAGACAGATTCCCAGCAT
TCCGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTGAAGGGTCAGACTTCACTCGTTGACATACTCCGCATGCGCGAACTTACTTTCGCACGAACT
GATACCGGCGGGGCCAGCAAAATTCGCGACTAACTGTGAGATATGTCTTCTCTTGACCACGATGTCCACCAGTA