Description :
From Genome Similarity Track
Location :
Scaffold_1034:4067- 7790
Transcript NameFunction/comments
Phyta_totarag11816hypothetical protein
Phyta_totarag11817hypothetical protein

Sequence
3723 bases(100 bases per row)
TCTTTTGGCGTCTGGTGGCCACATCTCGACGTCCACAAGCAACGGCGCGTTCtcttcgacgagcagcagctcgccgttGGTCTCCAACACGCCTGTAGCC
AGCGCATCACCCTCGCTTGCCATCCCGCGCTCGTCGCCGGCTATACCAGTTACTGCGTCGGCGCATCAACTTGCCGTGGCCTCCGTAGTCGTCATGATGG
CGGGGGGAATGCCTGGAGCACCAGTGGCAACTTCCTCTGTCGCTATGCAGCTTGTTCCACCATCACAGCCACCAGCCTCGCTAATGCTCGGCACTGGACC
ATTAAGCGTGCGCATTCCTGTGTCGCTTGATGACGTGCGCCTCGGCATTGGCCTTGAGCAAGGTACAGCCGGGTTGGTGTGCGCCATTCCGGTGCCGTGC
TTCCATTAGGCCGATCTCGCAGCGCTCCACAACATCACGGGTATCGGTGGTGCACTCAACCTTTTGGTACCAGCCGGGCAATGTGACCAGGCTCCACCAG
ACCTCACGGATGCTCGAGCTCGCTTTCGGATCGAGCGCGAAACGATTCCGCTGTTGCAGTGTTTTGGCGCCGACGGTTTTGCTCTTCGCACTCTAGGAAC
ATTGCGCTGTCTTCGTGCCATGTTGGAGCATGTGTACACGCTTCAGGGCCAAGACACACGCTCAGACCTCGCGGCTCAGAACCTCCGCTTGTCTGCCAAA
GTCAATGAACTGGCAGCGATACTGCTTCGCCAGAAGGAGTATTTCCAGGTTCAAACCACAGCACTCGAACAGCAACTTTTCTTCCGCTCGACCACTTCCG
GTTCCTCTCTGGATCCTGCTGATATTGCTCAAGGGCGTGAGGCCACCCGCTTCAGAAaacagcttgaagagctgAAAACCCGGCACGGCAACGTCGTCGC
TGACTGCCAACAGTTCCAGGACCAAGCTCACACCCGCGGCCAACGTGTCGGGGAGCTGAAAGCAGAACTCATCAATGCTGGAAATCGCTCTCCTGCAGCC
TTGATGGACTTCATCATGGCTCACTGCCGTTTCGAAGGCCACTGGCCTCggcttcttgagctgcttgaaaaTTACTGGAATGGTCATGATATGGCGGTTG
AAGCTCGGACTCGAATCGCCGTCCAGGCTCGAGACCGTGATAATGATGGTTGTAACCCATACATGTCGATGGCAACCAGTTCATAAACGCCTACAGTTGC
TTCCATAAGTTCTAGACAAGCCGCTCAGACGCTCTTGAATTTAGCGGGGTCCGCACTTGAGGCCACTCAatcgacgccatcgccaGAGTCCATAAAGTCA
AGTGACTCTCGGAAATCTTCGCGAGGTCCTCCGGGTGCGGCCTCTTCACGACGGGCACCGCCGGCCAAGTTGAACATCACTGGATCTTCGGTTTCTTCTC
GCCCGCCCAAAGCTAGTCACAAATCAAGCTCGGATACCAAAGCTACAGTGTCTCTGGCGGGGGCTGATTCGGTGTTAGTTGATTTGACAGGCTCGGCTCC
CAGCACTCCCAGATCCCGGGATGTCAAATCCTACATCGAGTGTTCAGCGCTGCAGAGTCGACCTCGGCGTCATctctccttggcctccacgCCGTTGACC
CTGTCGCCCAACAAGGCTCGGAGATTGACGCAGCTCGCGCGATTCCGAACCCGTTCTCGTGGGATAGGGCTCGGGCGGATGTTCGCGAGCTAATGATCGG
TGGACTTGGCTTCTGGGAAGCGGTGGACGGCGCCGGAAAGTCTCAGGCGTTGCATCACCGGTTCGGGTTGAAGGCACTGGTCTACATGCTGGAATCGATC
ATTTACTGGGAGGCCTTGGACTCCACGCCGTGGATGCGGTAACTTCTTTAAGATCGCTTTTCAACGCATCTAGGACGTGAATTTCGCACGGTCTCCTGAA
CACTGGGATCCTCTCACGAGTCGTCTTTCTTCGGGCAACGACGGCCAAGCATCTTTTCAGGACTATTATCCCTCAGAtttcgaggacgacgagcaagatg
atgatgctgagGACGAAACCTACCATGGACGACCACCCAAAGGAAAGAGTCCAATCAAGACGCGCTCTCGGCAACCTTCTTCTGGTGAGAAGCGTTCTCG
CACCAACACTGCTGCGGGCAAGAGTTCAGGATCCAAGAAAAATCGGCGCACGTTCCAATTCCCAGACGCGATCGAGGACCTGCCGGACAAGTACAAGCTT
CCGGCCCTGACTGTGTCGGATACGTACGTCGAAACTCCTAGTGGAAGGAGTTCGTGGTGCTACTACGGGGTCCTGGTCCAACGGTACACGTCTCAGACGA
TCGGTTTTCCAGACTACACTCCAACGCGGATTGATAATAAGTTGGTTCACGCGCGTTGGGACCCATTCGAGTACCTGGAGCTCATTCACGCGGCTCCGTG
GGAAGACATGTGGGAAAACTGGGTGAAGTTTCTGAGTCTTTTTCGCTACTCCGATTTGGGCCAGTCAATGGTCAAAGGCCTGCAGTGGATCCTGAATTTC
ATGTTTGTATGGAAGAGAGAATACTGGGAGCGGGGTCACTGGGTGACCATGACCTCGATCTTCTACTTCTGTCACGATCCTCGGTTCATGTTGCTCAGTG
ACGATCAGAAGCTGGAGGTGATCAATCTGTATCTTGACCGCAAGGCCCGGAGCAACACGTTcttcaaggccaaggaggagctcatgagGGAGTTCCAGAA
GATCGAAGGGTACGGCGAGGAAATCTGGTTCGAGGCTGGCTCTGGGTCATTCCGGAAAATCCTTGCAACTGAATTTGGCGTCACCCGGCCCAAGAGATAC
CGCTCAAGGAACAATTGGAAGAGATCGCCGAGTTGGAGCCTGCGCGTACGCAGTGGGCTTCACCGGTGTCGGATAACTGCTTCCTGGAAATCGTTCCGGA
TGACCTTCGCGGCCAGATGCTGTCTCAGAAAGAGCGCAAGGTCAACTTTCTTCCGAGACCTACTTCAGATGCTACACCGGGCTCTTCGCGTCGCTGAGCA
GGTTAACGCAGCTGCAGTCTCCCGCAAGGTGGCACCTTTCTTTTAGATTTGCATGTTTAACCACAGTAAATGACATTCACTTCCACCTCAATGCCTTCGT
GTTCATCTTCTGTTGCGTTGGTCTTTGTCTGCACGGAAACCGTTACCTGCACGACTTAACTGCACGCTGGGTTTCACAGAATTTCCATCTTCCTCACCAT
GCTCCTTTCACATCCAGCGTAACGGAGAAATGCATCGCTACTTTGCAAATTCAAACATACAACTTAAACACATGCACGATTCCTTCCGGGATTCACCTAC
TGAGCATCAGGCTCAGGTGGTTCATCTCCGGATTGCATTGCTTGGAACCGTCCTTGTGCCCAAGCGCTTTGGTTGAACTCGTATAACAATGCTCAACAGT
TGAGCTGGGATGCCGGGAGCCACTGCGGTTCCGGGTAATCCTTCCACTTAATCAAGTATTCTCGGACTCGCCTCGAGGTCCGGGTTCGTTTCACCCAACG
CACATCTTGGATTGTTTCAACTTCGTAGACATCTTTGTCATCACCAGGTTCCGACATATCTTCAGGCAATAGAGCAGCATCAAAGTCAGCTTCCTCTGCA
ATGTCCACTTAGATAGTTGGGCGATCTGGGAACAGAGCACGCGGCTTCAGGCGACTCACATGGACCCATGGGTAGACCTTATATCCAGAGCCTtcgatct
tcagcttgcAACGGTAATCGTCT